ID: 989522695

View in Genome Browser
Species Human (GRCh38)
Location 5:42420456-42420478
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522684_989522695 25 Left 989522684 5:42420408-42420430 CCTTCAAGTTAGGAGTCTGCCTG No data
Right 989522695 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
989522686_989522695 6 Left 989522686 5:42420427-42420449 CCTGGCCTGCTTAAGAAACAGCA No data
Right 989522695 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
989522689_989522695 1 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522695 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr