ID: 989522696

View in Genome Browser
Species Human (GRCh38)
Location 5:42420471-42420493
Sequence CAGAATGGATGACCCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522686_989522696 21 Left 989522686 5:42420427-42420449 CCTGGCCTGCTTAAGAAACAGCA No data
Right 989522696 5:42420471-42420493 CAGAATGGATGACCCAGTGATGG No data
989522689_989522696 16 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522696 5:42420471-42420493 CAGAATGGATGACCCAGTGATGG No data
989522694_989522696 -8 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522696 5:42420471-42420493 CAGAATGGATGACCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522696 Original CRISPR CAGAATGGATGACCCAGTGA TGG Intergenic
No off target data available for this crispr