ID: 989522697

View in Genome Browser
Species Human (GRCh38)
Location 5:42420472-42420494
Sequence AGAATGGATGACCCAGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522689_989522697 17 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522697 5:42420472-42420494 AGAATGGATGACCCAGTGATGGG No data
989522686_989522697 22 Left 989522686 5:42420427-42420449 CCTGGCCTGCTTAAGAAACAGCA No data
Right 989522697 5:42420472-42420494 AGAATGGATGACCCAGTGATGGG No data
989522694_989522697 -7 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522697 5:42420472-42420494 AGAATGGATGACCCAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522697 Original CRISPR AGAATGGATGACCCAGTGAT GGG Intergenic
No off target data available for this crispr