ID: 989522700

View in Genome Browser
Species Human (GRCh38)
Location 5:42420483-42420505
Sequence CCCAGTGATGGGGAAATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522689_989522700 28 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522700 5:42420483-42420505 CCCAGTGATGGGGAAATTCATGG No data
989522694_989522700 4 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522700 5:42420483-42420505 CCCAGTGATGGGGAAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522700 Original CRISPR CCCAGTGATGGGGAAATTCA TGG Intergenic
No off target data available for this crispr