ID: 989522702

View in Genome Browser
Species Human (GRCh38)
Location 5:42420484-42420506
Sequence CCAGTGATGGGGAAATTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989522689_989522702 29 Left 989522689 5:42420432-42420454 CCTGCTTAAGAAACAGCAGGGAG No data
Right 989522702 5:42420484-42420506 CCAGTGATGGGGAAATTCATGGG No data
989522694_989522702 5 Left 989522694 5:42420456-42420478 CCGGTGTGCTGGGAGCAGAATGG No data
Right 989522702 5:42420484-42420506 CCAGTGATGGGGAAATTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989522702 Original CRISPR CCAGTGATGGGGAAATTCAT GGG Intergenic
No off target data available for this crispr