ID: 989523212

View in Genome Browser
Species Human (GRCh38)
Location 5:42424484-42424506
Sequence GACACAGCGCGCAGAGCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989523204_989523212 25 Left 989523204 5:42424436-42424458 CCCCGGCAGCGCGACTGGAGAGA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 80
989523206_989523212 23 Left 989523206 5:42424438-42424460 CCGGCAGCGCGACTGGAGAGACT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 80
989523205_989523212 24 Left 989523205 5:42424437-42424459 CCCGGCAGCGCGACTGGAGAGAC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989523212 Original CRISPR GACACAGCGCGCAGAGCGCG CGG Exonic
900227034 1:1537775-1537797 GACACACCGTGCACAGGGCGGGG - Intronic
903766459 1:25737973-25737995 GACACAGCGTGCAGAACCCATGG - Intronic
905735161 1:40319953-40319975 GACAAAGCGGGCAGATCACGAGG - Intergenic
913960296 1:143333951-143333973 GACAGCGCGCCCAGAGCCCGAGG - Intergenic
914054652 1:144159524-144159546 GACAGCGCGCCCAGAGCCCGAGG - Intergenic
914124494 1:144806837-144806859 GACAGCGCGCCCAGAGCCCGAGG + Intergenic
916107267 1:161441174-161441196 GAGACAGCAGGCAGGGCGCGCGG - Intergenic
916108854 1:161448592-161448614 GAGACAGCAGGCAGGGCGCGCGG - Intergenic
916110442 1:161455973-161455995 GAGACAGCAGGCAGGGCGCGCGG - Intergenic
916112027 1:161463383-161463405 GAGACAGCAGGCAGGGCGCGCGG - Intergenic
916113614 1:161470764-161470786 GAGACAGCAGGCAGGGCGCGCGG - Intergenic
922989821 1:229897070-229897092 GACATAGCGCGCTGAGCCTGTGG + Intergenic
923171657 1:231422275-231422297 TGCAGAGCGCGCAGAGCGAGTGG - Exonic
923902650 1:238344712-238344734 GACAAAGCGGGCAGATCACGAGG - Intergenic
1073326046 10:102644415-102644437 GACGCAGCCCGCTGCGCGCGCGG + Intergenic
1076395825 10:130136712-130136734 GGAACAGCGAGCAGGGCGCGAGG + Intronic
1076659749 10:132047777-132047799 CACTCAGCTCGCAGAGGGCGGGG - Intergenic
1077028018 11:450357-450379 CACACAGCGCGAGGAGCGCTGGG - Exonic
1077093835 11:791108-791130 CACACAGCACACAGAGCGCCTGG + Exonic
1083838978 11:65292271-65292293 GAGAAAGCGAGCAGAGCCCGCGG + Intronic
1101340321 12:103837233-103837255 GACACAGCGCACACAGCATGGGG + Intronic
1104841749 12:131829013-131829035 CACGCAGCGCGCAGAGCTCGGGG - Intronic
1108409311 13:50130826-50130848 GGCCCAGCGCGGAGAGCGCCCGG - Intronic
1119481960 14:74963502-74963524 GACACAGTGTGCAGAGGGTGAGG - Intergenic
1123701665 15:22918658-22918680 GGCACAGCGGGCACAGGGCGTGG + Intronic
1129894021 15:79090560-79090582 GAGGCAGCGCGCAGCGCGCACGG - Exonic
1132483968 16:180804-180826 GGCTCAGCGCGGACAGCGCGTGG - Exonic
1139576702 16:67846771-67846793 GACACGGCCCGCAGCGCGGGAGG - Exonic
1140196344 16:72858800-72858822 GACACAGAGGGCAGAGCCCCAGG + Intronic
1142164822 16:88580664-88580686 GAGACAGGGAGCAGGGCGCGGGG - Intronic
1147585017 17:41648961-41648983 TACACTGCGGGCAGAGCGCGAGG + Intergenic
1153228351 18:2914402-2914424 GACACAGCTCGCCGAGCTCTTGG + Exonic
1160934061 19:1584888-1584910 GCCACAGGGTGCAGAGCGCAAGG - Intronic
1161090201 19:2356267-2356289 GACTCAGCGCACAGAGCCCTGGG + Intergenic
1161252168 19:3286058-3286080 GACAGGGCGGGCAGAGGGCGGGG - Intronic
1163480828 19:17555470-17555492 CACATAGCGCTCGGAGCGCGTGG - Intergenic
1165383239 19:35495518-35495540 GCCACAGGGGGGAGAGCGCGGGG - Intronic
1168059704 19:53883899-53883921 GACACAGAGCACAGAGCTCAGGG - Intronic
1202694133 1_KI270712v1_random:112202-112224 GACAGCGCGCCCAGAGCCCGAGG - Intergenic
925289300 2:2736293-2736315 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
925289306 2:2736328-2736350 GACTCAGAGAGCAGAGCTCGGGG + Intergenic
925289376 2:2736826-2736848 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
925289382 2:2736861-2736883 GACTCAGAGAGCAGAGCCCGGGG + Intergenic
925383989 2:3449172-3449194 GAGACAGCCTGCAGGGCGCGTGG - Intronic
932595098 2:73088604-73088626 GACACAGAGCGAAGAGCGGGAGG + Exonic
937201173 2:120205430-120205452 GTCACAGAGCGCTGAGCGGGAGG - Intergenic
943333800 2:186590133-186590155 GACGAGGGGCGCAGAGCGCGCGG - Exonic
946311222 2:218883577-218883599 GAAACAGCGCCCGGGGCGCGCGG - Intronic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
1170927822 20:20741861-20741883 GACACAGTGCCCAGAGTGCCGGG - Intergenic
1171387338 20:24779253-24779275 GGCACAGCGAGCAGAGCTCTGGG - Intergenic
1172693261 20:36804749-36804771 GACAGAGCGGGCAGAGCTCAAGG - Exonic
1176210783 20:63920299-63920321 GACACAGAGCACAGAGTGCCGGG - Intronic
1179487951 21:41722765-41722787 GACACGGAGAGCAGAGCCCGTGG + Intergenic
1179522369 21:41953731-41953753 GCCACAGCGCGCTGGGGGCGTGG + Exonic
1180037551 21:45257547-45257569 GCCACAGACCGCAGAGCCCGCGG + Intergenic
1180876839 22:19178642-19178664 GCCAGAGCGCGCGGGGCGCGGGG + Exonic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
959984937 3:112561847-112561869 CAGACAGCTCGCAGAGGGCGAGG - Exonic
962443908 3:135448359-135448381 GACACAGCGTGCAGAGTAAGAGG + Intergenic
968909840 4:3472135-3472157 GCCACAGCCCGCAGAGCCAGGGG - Intronic
974386048 4:61202367-61202389 GACACAACAGGCAGGGCGCGGGG - Intronic
982384039 4:154781254-154781276 TTCCCAGCGCGCAGCGCGCGCGG - Exonic
985472773 5:55851-55873 GAGACAGGGCGCAGAGCGGCAGG - Intergenic
985629874 5:1008837-1008859 GCCACCGGGCGCAGGGCGCGGGG - Exonic
987397061 5:17434136-17434158 GACACAGGGAGCAGAGTGAGTGG - Intergenic
989523212 5:42424484-42424506 GACACAGCGCGCAGAGCGCGCGG + Exonic
1004444377 6:15684871-15684893 GGCACAGGGTGCAGAGGGCGAGG - Intergenic
1013429103 6:110040140-110040162 GACACCGCGCGCAGAGACAGAGG - Intergenic
1016462007 6:144286969-144286991 GCCAGAGCGCGCGGAGCTCGGGG + Intronic
1017536039 6:155349080-155349102 GACACAGCTCCCAGAGGGAGAGG - Intergenic
1018676486 6:166226557-166226579 AACACAGCCTGCAGAGCGAGAGG - Intergenic
1026523140 7:71133109-71133131 GGCACAGGGCGCAGCGCGCAAGG - Intronic
1026869606 7:73842286-73842308 GACACTGAGCGCAGAGAGGGCGG + Intronic
1035247848 7:157576566-157576588 GGCAGTGCGCGCTGAGCGCGCGG - Intronic
1037311587 8:17562017-17562039 GAAACAGCGCGAGGAGAGCGAGG - Exonic
1037779916 8:21860900-21860922 GACACAGTGCGCAGAGAGCATGG + Intergenic
1039453663 8:37695024-37695046 GGCACAGCGCGCACAGCCTGGGG + Intergenic
1044320079 8:90791716-90791738 GACACCGAGCGCGGAGAGCGCGG + Exonic
1049246304 8:141564570-141564592 GACACAGCGCCCAGGGAGCTGGG + Intergenic
1052781256 9:32783568-32783590 AGCTCAGCGCGCAGAGCGCGGGG - Exonic
1060152882 9:121299906-121299928 GCGACAGCGCGCACAGCGCCAGG - Exonic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1061621183 9:131812337-131812359 GACACAGCACACAGAGCCCTTGG + Intergenic
1061973890 9:134058800-134058822 GACACAGTGGGCTGAGCGAGGGG - Intronic
1190321952 X:49184847-49184869 GGGACAGCGCCCAGAGTGCGGGG + Intronic