ID: 989534714

View in Genome Browser
Species Human (GRCh38)
Location 5:42550374-42550396
Sequence CAGGGGAACCTTGGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989534714_989534724 1 Left 989534714 5:42550374-42550396 CCTGCCTCCCCAAGGTTCCCCTG 0: 1
1: 0
2: 3
3: 42
4: 390
Right 989534724 5:42550398-42550420 GCCCCATCACTACTAACCCTAGG 0: 1
1: 0
2: 2
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989534714 Original CRISPR CAGGGGAACCTTGGGGAGGC AGG (reversed) Intronic
900407392 1:2498630-2498652 CTGGGGGACCGTGGGGAGGTGGG + Exonic
900540943 1:3202368-3202390 TAGGGGAGGCTGGGGGAGGCTGG + Intronic
900921787 1:5676978-5677000 CAGGCGGACGTTGGGGAGGGAGG + Intergenic
901029573 1:6299122-6299144 CTGGGTGACCTTGGGCAGGCAGG + Intronic
901418910 1:9137091-9137113 CAGGGCCCCCTTGGGGATGCTGG - Intergenic
901772562 1:11537721-11537743 CAGGGCACCCTAGGGGAGGTGGG + Intergenic
902115052 1:14114353-14114375 CTGGGGATCCCTGGGGAGGCAGG + Intergenic
902638018 1:17747761-17747783 CTGGGGACCCTTCAGGAGGCCGG + Intergenic
902728280 1:18351633-18351655 CCACGGAAGCTTGGGGAGGCAGG - Intronic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902930869 1:19730628-19730650 AAGGGGCACCTTGGGAAGGGTGG + Intronic
903135867 1:21308831-21308853 AAGGGAAACCCTGGGCAGGCAGG - Intronic
903354731 1:22739718-22739740 CAGGTGACCCTTGGGGAGTCAGG + Intronic
903561980 1:24235014-24235036 CAGGGGACACTTGACGAGGCTGG + Intergenic
903974056 1:27137833-27137855 CAGGGGCACATTGGGGAGGGAGG - Intronic
904037191 1:27565220-27565242 TAGGGGTGCCTGGGGGAGGCAGG - Intronic
904286253 1:29454855-29454877 GAGGGGCAGCTTGGGGAGGTGGG - Intergenic
904417987 1:30374525-30374547 GAGGGGCAGCTTGGGGAGGTGGG + Intergenic
904603511 1:31686260-31686282 CAGGGTAACTTCGGGGAGGCAGG - Exonic
904603856 1:31688543-31688565 CCGGGGAGCCTTGGAGAGGTGGG - Intronic
905014970 1:34771614-34771636 CAGGGGAGCCTTGGGGCCCCAGG - Intronic
905417703 1:37815660-37815682 CATGGGAACCATGGGAAGGATGG + Intronic
905917726 1:41697486-41697508 CATGGGAACCTTTGAGAGGATGG + Intronic
907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG + Intronic
909980848 1:82099002-82099024 GAGGGGTAACTTGGGGAGCCAGG - Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
914875711 1:151511565-151511587 CAGGGGTACCTTTGAGGGGCAGG + Intronic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915508415 1:156371966-156371988 TGGGGGAAGGTTGGGGAGGCGGG + Intronic
915588358 1:156857354-156857376 CAGGGGAGCCCTGGAGAGGCAGG - Intronic
915741766 1:158124206-158124228 CAGGGAAACAATGGGGAGTCAGG - Intergenic
917789822 1:178492388-178492410 CAGGGGAACAGAGGGGACGCGGG + Intergenic
917853005 1:179081565-179081587 CAGGGCAACCTTGGCCAGACAGG + Exonic
918262221 1:182806444-182806466 CAGCGGAACCTCTGGGTGGCAGG - Intronic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
923445739 1:234069670-234069692 CTGAGGACCCTGGGGGAGGCTGG - Intronic
924709066 1:246519346-246519368 CAGAGGACCCTGGGGGAGGTGGG - Intergenic
924883883 1:248190922-248190944 CTGGGGACCCCTTGGGAGGCAGG - Intergenic
1063432101 10:5999708-5999730 CAGGGGATCGGTGGGGAGCCAGG + Intergenic
1065342769 10:24723023-24723045 CGGGGGAATCGTGGGGAGGTGGG - Intronic
1065916502 10:30358171-30358193 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1066005410 10:31142215-31142237 CAGGGCAACCCTGGTGAGTCAGG - Intergenic
1067530298 10:47066256-47066278 CAGGGGACACCTGTGGAGGCTGG - Intergenic
1067688274 10:48480976-48480998 CAGCGGGCCCGTGGGGAGGCAGG + Intronic
1070825359 10:79387546-79387568 CAGGGGACCCTTCTGCAGGCAGG - Intronic
1070828306 10:79403855-79403877 CAGGAAAACCCTGGGGAGGGGGG + Intronic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1071385537 10:85116565-85116587 CAGGAGAACATTTGGGAGGGTGG - Intergenic
1073199780 10:101725998-101726020 CAGGGAAGCCTTGGCTAGGCTGG - Intergenic
1074982011 10:118627265-118627287 CAGGGAAAACTTGGAAAGGCAGG + Intergenic
1075991304 10:126841198-126841220 CAGGCTAAGCCTGGGGAGGCTGG - Intergenic
1076590137 10:131577141-131577163 CGGGGGACCCTTGGAGAGGCTGG + Intergenic
1076602777 10:131669775-131669797 CAGTGGAAACTTGGGAAGGCAGG + Intergenic
1076731779 10:132442825-132442847 CCCGGGGACCTCGGGGAGGCAGG - Intergenic
1076813958 10:132905317-132905339 CAGGAGGACCCTGGGGAGGGCGG - Intronic
1076904217 10:133354384-133354406 CAGGAGAACCTTGGGGGTGCAGG - Intergenic
1077442104 11:2573671-2573693 CCCGGGAGCCTTGGGGAAGCCGG + Intronic
1079074158 11:17373303-17373325 CAGGTGTACCTTGGGGATACTGG - Exonic
1079327296 11:19505178-19505200 CAACTGAACCTTGGGGAGGGTGG + Intronic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080263685 11:30378436-30378458 CAGTAGAATCTTGGGGAGGGGGG + Intergenic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1083300119 11:61735725-61735747 CAGGGCATCCTTGGGGAGAGAGG - Exonic
1083635907 11:64120929-64120951 CAGGGGGACCTAGGTGAGGTGGG - Intronic
1084196329 11:67525109-67525131 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196346 11:67525151-67525173 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084196363 11:67525194-67525216 CAGAGGGACCCTGGGGAGGAGGG - Intergenic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1087723559 11:101693935-101693957 CTGGGGAACCAGGGGGAGCCTGG + Intronic
1089134379 11:116237614-116237636 TAGGAGAACCTCCGGGAGGCTGG - Intergenic
1089555060 11:119311643-119311665 AAGGGGGGCCTTGGGGAGGTAGG + Exonic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1090212553 11:124932596-124932618 AAGGTAAATCTTGGGGAGGCAGG + Intronic
1090238447 11:125165703-125165725 CTGGGGATCTTTGGTGAGGCGGG + Intronic
1092003794 12:5052040-5052062 CTGGGGATCCTGGAGGAGGCAGG + Intergenic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1094849197 12:34374804-34374826 CAGGGGACCCTTGGTGTGCCTGG - Intergenic
1094852453 12:34388387-34388409 CAGGGGAACCTGGGGGTCCCTGG - Intergenic
1095745027 12:45648447-45648469 CAGGGGAAGGTTGGAGAGCCAGG - Intergenic
1095938023 12:47705891-47705913 TAGGAGATCCTTGGGGTGGCCGG - Intronic
1096255328 12:50058737-50058759 GAGGGGATCCTGGGGGAGGAGGG - Exonic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097683520 12:62671118-62671140 CAGGGGAACTTTGAGGATGTGGG - Intronic
1101707789 12:107236770-107236792 CTGGGTAACCTTGGCGAGTCTGG + Intergenic
1101959020 12:109234111-109234133 GAGGCGGCCCTTGGGGAGGCAGG + Intronic
1102339327 12:112109174-112109196 CAGGGGAAAGTTGGGGAAGCGGG + Intergenic
1103440767 12:120961245-120961267 TAGGCAAAACTTGGGGAGGCTGG - Intergenic
1104981942 12:132577152-132577174 CAGGTCCACCCTGGGGAGGCTGG - Intronic
1106009553 13:25806154-25806176 CAGGGGTAAGTTGAGGAGGCGGG + Intronic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1106940631 13:34775053-34775075 CAGAGAAACCTTGAGGAGCCTGG + Intergenic
1111417651 13:87969972-87969994 CAGTGGGACCCTGGGAAGGCAGG + Intergenic
1111941383 13:94611773-94611795 CTGGGGATCCTGGGGGTGGCCGG - Intronic
1113051937 13:106221862-106221884 CAGGTGAACAGTGTGGAGGCAGG + Intergenic
1113612664 13:111658434-111658456 CAGGGGAAGTGTGGGCAGGCCGG + Intronic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1113782822 13:112986484-112986506 CAGTGGGACCGTGGGGAGGTGGG - Intronic
1113951216 13:114072097-114072119 CGGGGGAAGCATGGGGCGGCTGG - Intronic
1114416920 14:22551109-22551131 CTGGGGACCCTGGGGGAGGAGGG - Intergenic
1115493484 14:33981125-33981147 CAGGGCAGCCGTGGGGAGTCAGG - Intronic
1119955764 14:78797134-78797156 CAGGGGAACCTTTCTGAGGGGGG + Intronic
1121273417 14:92652285-92652307 CTGAGGTCCCTTGGGGAGGCAGG - Exonic
1121410228 14:93744390-93744412 CAGGGTGCCCTTGCGGAGGCCGG + Intronic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1121793395 14:96716080-96716102 GAGGGGAACCTTGGGGACGCAGG - Intergenic
1121970640 14:98352898-98352920 CAGAGGAATCTTGGGGGGGTGGG - Intergenic
1122032740 14:98925475-98925497 CAGGGGAAAGTTGCAGAGGCCGG + Intergenic
1122098149 14:99386521-99386543 CAGTGGACCCCAGGGGAGGCGGG - Intergenic
1122529813 14:102417860-102417882 CAGGGGAGCCGTGGGGAGGCTGG + Intronic
1122529834 14:102417926-102417948 CAGGGGAGCCGCAGGGAGGCAGG + Intronic
1122599027 14:102912217-102912239 CAGGGGACCCTGGGAGTGGCAGG - Intergenic
1122893264 14:104742729-104742751 CATGGGCAGCTGGGGGAGGCGGG - Intronic
1123032092 14:105456767-105456789 CAGGGGTACCCTGGGGAAGCTGG - Intronic
1123113096 14:105882130-105882152 CAGGGCAGCTTTGGGGAGGGAGG - Intergenic
1202872475 14_GL000225v1_random:177382-177404 CAGGGCAACCGTAGGGACGCCGG - Intergenic
1124462728 15:29907774-29907796 CGCGGGAACCTGGGGGAAGCTGG - Intronic
1124490360 15:30151475-30151497 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1124642217 15:31402676-31402698 CAGGTGGAGCCTGGGGAGGCAGG + Intronic
1124753173 15:32386854-32386876 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1124974912 15:34522554-34522576 GAAGGGACCCTGGGGGAGGCAGG - Intergenic
1127265158 15:57355142-57355164 CAGGGAAACCAAGGGGAGCCCGG - Intergenic
1127734321 15:61827834-61827856 GAGGGGAGTTTTGGGGAGGCGGG - Intergenic
1127980631 15:64032519-64032541 CAGGGGCAGGTTGGAGAGGCTGG - Intronic
1128332221 15:66763297-66763319 CAGGGGCACCCTGGGGAGACTGG + Intronic
1128944197 15:71810398-71810420 CCGGGGGACCTTGGGCAGCCCGG + Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130282752 15:82532225-82532247 GAGAGGACCCTGGGGGAGGCAGG + Intergenic
1130362013 15:83197940-83197962 CAGGAGAACCTGGGGGCGGCGGG + Intronic
1130794905 15:87197554-87197576 CAGGGGCCCCTTCGGCAGGCTGG + Intergenic
1131262150 15:90893040-90893062 CTGGGGGGCCCTGGGGAGGCGGG + Intronic
1132185447 15:99798792-99798814 GAGGGGACCCTGGGGGAGGTAGG + Intergenic
1132552451 16:559186-559208 CAGGGGTGCCTTGGGGAAGAAGG - Intergenic
1132743563 16:1427652-1427674 AAGGGGAACCCAGGGGTGGCCGG - Intergenic
1132857890 16:2055215-2055237 CAGGGGAGCCCAGGGCAGGCCGG - Intronic
1133223524 16:4329120-4329142 CAGAGGAGCTTCGGGGAGGCTGG + Exonic
1133398316 16:5465946-5465968 CAGGGGCACCTTGTTGAGTCTGG + Intergenic
1133747201 16:8696279-8696301 CAGGGGGACCCTGGGGAAGAAGG + Intronic
1134134491 16:11669845-11669867 CTGGGGAACCTAGGGGATTCTGG + Intronic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1135156039 16:20053376-20053398 CAAGGAAACCCTGGGCAGGCAGG - Intronic
1135403446 16:22181787-22181809 CAGGGGAGCTTGGGGGAAGCAGG + Intronic
1135688183 16:24515066-24515088 CAGGGGCAGCTTAGGAAGGCTGG + Intergenic
1135792978 16:25415067-25415089 CATGGAATACTTGGGGAGGCTGG + Intergenic
1136238793 16:28931944-28931966 CAGGGGATGCTGGGGCAGGCAGG - Exonic
1136537358 16:30907900-30907922 CAGGGGAGCCTAGGAGAGGAGGG - Intergenic
1137487417 16:48903179-48903201 CTAGGGAAGCCTGGGGAGGCTGG + Intergenic
1139373039 16:66480190-66480212 AAGGGGAACTTTGGAGTGGCTGG + Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1139572377 16:67821236-67821258 CAGAAGAAACTTGGGGAGGGCGG + Intronic
1139594818 16:67951387-67951409 CAGGGCAACTTTGGGGACTCAGG + Intronic
1141136883 16:81472457-81472479 CAGGGGACCCCTGGGGAGATGGG - Intronic
1141441324 16:84031511-84031533 CAGGGGAACAGTGAGGAGGCCGG - Intronic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142294237 16:89209869-89209891 CAGGGAGACCTGGGGGAGACCGG + Intergenic
1142374111 16:89697954-89697976 CAGGGGAGCCTCGGGGGGGCAGG + Exonic
1142674855 17:1507393-1507415 GAGGGGAACCTGGGGAAGCCAGG + Intronic
1142752315 17:1996393-1996415 CAGGGGGACCTTGGGCCGGGGGG - Intronic
1142831430 17:2552036-2552058 CAAGGGAACCTTGCGGCGGCTGG + Intergenic
1143052219 17:4135631-4135653 GATGGTAACTTTGGGGAGGCAGG - Intronic
1143521828 17:7448630-7448652 CAGGCGATCCTAGGGGAGGGAGG + Exonic
1143563554 17:7708761-7708783 CAGAGGAAGCTGGGGAAGGCAGG - Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143731472 17:8885157-8885179 CAGGTGGGCCCTGGGGAGGCAGG - Intronic
1144631864 17:16877693-16877715 CAGGGGGACATGGGGGAGGCAGG - Intergenic
1145006653 17:19342379-19342401 CAGGGCAACATGGGCGAGGCTGG + Intronic
1145023866 17:19453231-19453253 CAGGGGATCCTGGGTGAGGATGG - Intergenic
1145871311 17:28276010-28276032 CAGGGGACCCTTTGGGGAGCAGG - Intergenic
1146474846 17:33154453-33154475 CATGGGAATCTTGGGGAGATGGG + Intronic
1146844394 17:36174034-36174056 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1146856699 17:36261969-36261991 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1146863918 17:36326406-36326428 CAGAGGATCCCTGGGGAGGTAGG + Intronic
1146872608 17:36385880-36385902 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1146879967 17:36436965-36436987 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1146883888 17:36458116-36458138 CAGAGGATCCCTGGGGAGGTAGG - Intergenic
1147066778 17:37926994-37927016 CAGAGGATCCCTGGGGAGGTAGG + Intronic
1147075493 17:37986504-37986526 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1147078310 17:38006555-38006577 CAGAGGATCCCTGGGGAGGTAGG + Intronic
1147087018 17:38066050-38066072 CAGAGGATCCCTGGGGAGGTAGG - Intronic
1147094248 17:38130490-38130512 CAGAGGATCCCTGGGGAGGTAGG + Intergenic
1147102963 17:38190013-38190035 CAGAGGATCCCTGGGGAGGTAGG - Intergenic
1147160195 17:38565033-38565055 CAGAGGCTCCTGGGGGAGGCTGG - Intronic
1147605271 17:41770722-41770744 CAGGGGAGGCTTGGGCTGGCGGG + Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148340808 17:46872470-46872492 CAGGTGAGCCTTGGGGATGGTGG - Intronic
1151338575 17:73455531-73455553 CTGGGGGACCTTGGAGAGGCTGG - Intronic
1151635106 17:75341779-75341801 CAGGGAAACATTGGTGAGTCAGG + Intronic
1152595291 17:81234813-81234835 CAGGGGCAGCGTGGGGTGGCAGG - Intronic
1152625078 17:81384314-81384336 CCCGGGCACCTAGGGGAGGCTGG + Intergenic
1152645196 17:81465515-81465537 CAGGGGAACCTTAGTGTGGGAGG - Exonic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1152987665 18:334888-334910 CAGGGCACCGTTGGGGAGCCTGG - Exonic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153523988 18:5977870-5977892 AGGGGCAGCCTTGGGGAGGCAGG - Intronic
1153790177 18:8571655-8571677 CAGGGGTTCCCTGTGGAGGCTGG - Intergenic
1155550082 18:26955522-26955544 CAAGGAAGCCTTGGGTAGGCTGG + Intronic
1156520874 18:37721476-37721498 AAGGGGAACCTTGAGTGGGCTGG + Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157682259 18:49616321-49616343 CAGGGGTGCCAAGGGGAGGCTGG - Intergenic
1159886367 18:73911529-73911551 CACGGAAATGTTGGGGAGGCCGG + Intergenic
1160425066 18:78773726-78773748 CAGGGAACCCCTGGGCAGGCAGG + Intergenic
1160833621 19:1114403-1114425 CAGGGCGACCTCGGGGACGCGGG - Exonic
1160853722 19:1206568-1206590 CTCGGGGACCCTGGGGAGGCCGG - Exonic
1160910026 19:1469999-1470021 GATGGGAGCCTTGGCGAGGCTGG - Exonic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161154889 19:2727429-2727451 CAGGGGGACCCTGGAAAGGCTGG + Intronic
1161176755 19:2847972-2847994 TAGGTAAACCCTGGGGAGGCAGG - Intronic
1161241382 19:3225433-3225455 CAGGGGAGCCTCGGGAACGCCGG + Intronic
1161552684 19:4923022-4923044 CAGGAGCAGCTTGGGGAGCCAGG - Intronic
1161578342 19:5067092-5067114 CAGGGGAGCCTTCGGGAGGGAGG - Intronic
1162323656 19:9985876-9985898 CAGGGCAAGCTTGGGGTGCCAGG - Exonic
1162926044 19:13930938-13930960 CAGGGGAACCGGGGGGTGGGTGG - Intergenic
1163255356 19:16152928-16152950 CATGGGAACCTGGGGTAGTCTGG + Intronic
1163546132 19:17942456-17942478 CAGGGGAACCTTGGACAGGGCGG - Intronic
1163737498 19:18990372-18990394 CAGAGGAACCATGGGCAGGCTGG + Intergenic
1163866439 19:19777040-19777062 CATGGCAACTTTGGGCAGGCTGG - Intergenic
1165170763 19:33890118-33890140 CAGGGAAGCCATGGGGAGTCCGG + Intergenic
1165406508 19:35634106-35634128 CAGGAGGACCTGGGGGAGGGAGG + Intronic
1167043883 19:47039039-47039061 GGGGGGCACCTTGGTGAGGCTGG - Exonic
1167223833 19:48222901-48222923 CAAGGGGACTTTGGGGAAGCTGG + Intronic
1167271152 19:48507141-48507163 CATGGGAGACTTGGGGTGGCTGG + Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1168467449 19:56614893-56614915 CAGGGGATCCCTGGGGATGGGGG - Intronic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
925507467 2:4584245-4584267 TAGGGGAACAATGGGGAGGTGGG - Intergenic
925641126 2:5986714-5986736 CAGAGGAACCTGGGCCAGGCTGG - Intergenic
926358404 2:12062550-12062572 CAGGGGAACCTGGCAGAGGCAGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926799104 2:16643336-16643358 CAGGGGGAGCTTGAGGAGCCAGG + Intronic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
928120574 2:28581001-28581023 GAGGGGAGCCTTGGGGCTGCTGG + Intronic
928399777 2:30969408-30969430 CAGGGGCAAGTTGGGGAGGGAGG + Intronic
928433450 2:31238909-31238931 CCCGGGCTCCTTGGGGAGGCTGG + Intronic
928805077 2:35140652-35140674 CAGGGGATCCTTGGGTACCCTGG - Intergenic
929815062 2:45223832-45223854 CAGGAGAACCTCAGGGAGACTGG + Intergenic
932283745 2:70515782-70515804 CAAGAAAACCTAGGGGAGGCAGG + Intronic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932607730 2:73175992-73176014 CGGGGGATACTCGGGGAGGCAGG + Intergenic
933774530 2:85764212-85764234 CTGGGGAGCATAGGGGAGGCAGG + Intronic
934651138 2:96091942-96091964 CAGGGGAAGCTTGGTGAGGCAGG + Intergenic
934663976 2:96157634-96157656 CAAGGGCTCCTTGGGGAGGTAGG - Intergenic
935548275 2:104423865-104423887 CAGGGAAGACTTGGGGAGGTTGG - Intergenic
935598893 2:104902031-104902053 CAGGGGAAATTTGGGGAGTCAGG + Intergenic
936061743 2:109299206-109299228 CAGGCAGTCCTTGGGGAGGCAGG - Intronic
936501654 2:113071709-113071731 CTGAGGGACCCTGGGGAGGCAGG - Intronic
937297762 2:120820026-120820048 CATGGGAACCTGGGGAAGGTTGG + Intronic
940510117 2:154603082-154603104 CAGGCTAGCCTTGGGGAGGTCGG + Intergenic
941911742 2:170770943-170770965 CCGGGGAACCACGGAGAGGCAGG - Intergenic
942389646 2:175478693-175478715 CAGGGGAACCTGTGAGATGCAGG - Intergenic
942470082 2:176251000-176251022 CAGGGGAACCCTGCAGAGGGCGG - Intergenic
943580803 2:189681721-189681743 CAGGTGATCCCTGGGGAGGGAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946690383 2:222304844-222304866 CAGGGCCACCGTGGGGAGCCGGG - Exonic
947015734 2:225617801-225617823 CAGGGAAACATTGGAGAGGTGGG + Intronic
947337344 2:229101080-229101102 CAATGGAAACTTGGGGAGGATGG + Intronic
947635789 2:231680305-231680327 CTGGGGACACCTGGGGAGGCGGG + Intergenic
947840040 2:233201987-233202009 GAGGGGAAGCTTGGTGGGGCGGG - Intronic
948055157 2:235005391-235005413 CACTGGAACCTGGGGGAGACAGG - Intronic
948613369 2:239183711-239183733 CAGGGGTGCGGTGGGGAGGCAGG - Intronic
948995616 2:241576790-241576812 CAGGGGAACCGAGGAGAGCCGGG - Intergenic
948995634 2:241576849-241576871 CAGGGGAACCGAGGAGAGCCGGG - Intergenic
1170480659 20:16761866-16761888 CAGGGGCACCATGGGGTGGCTGG + Intronic
1171099137 20:22366089-22366111 TAGGGGCACCGAGGGGAGGCAGG - Intergenic
1173057916 20:39634396-39634418 CACTGGAACGTTGGGAAGGCTGG - Intergenic
1173361933 20:42352354-42352376 TAGAGGAACCTTAGGGAGGCGGG + Intronic
1176023359 20:62973618-62973640 TAGGAGAGCCCTGGGGAGGCTGG - Intergenic
1176097906 20:63352768-63352790 CAGAGGACCCTGGGGGAGGGGGG - Intronic
1176376164 21:6087786-6087808 CAGGGCCACATTGGGGAGGGTGG - Intergenic
1176431037 21:6575849-6575871 TATGGGAACCTGGGGGAGACTGG + Intergenic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1179218981 21:39389793-39389815 CAGGGTAACAGTGGTGAGGCAGG - Intronic
1179706431 21:43183311-43183333 TATGGGAACCTGGGGGAGACTGG + Intergenic
1179747311 21:43450458-43450480 CAGGGCCACATTGGGGAGGGTGG + Intergenic
1179918946 21:44496755-44496777 CAGGGGAAGACTGGGGAGGTGGG + Intergenic
1180205471 21:46256749-46256771 CAGGGGAGCCCTGACGAGGCAGG + Intronic
1180723530 22:17927518-17927540 CAGGCTAACCTTGGGGCTGCAGG + Intronic
1180949801 22:19715828-19715850 GAGGGGCCCCTTGGGGAGCCAGG + Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1182357491 22:29728885-29728907 CATGGGCTCCCTGGGGAGGCCGG + Intronic
1182416044 22:30222117-30222139 CAGGAGAACCATGGGGATGTTGG + Intergenic
1183101459 22:35586683-35586705 CTGGGGACCCTCTGGGAGGCTGG - Intergenic
1184175880 22:42788467-42788489 GAAGGGACCCTGGGGGAGGCAGG + Intergenic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184716993 22:46288066-46288088 TGGGGGATCCTTGGGGAGGTCGG + Intronic
1184801515 22:46763121-46763143 CCTGGGCTCCTTGGGGAGGCTGG + Intronic
949944215 3:9177446-9177468 CTGGGGGACCTGGAGGAGGCAGG + Intronic
953881578 3:46693843-46693865 CAGGAGAGGCTTGGGGCGGCGGG - Intergenic
954134653 3:48576416-48576438 CAGGGTGACCGTGGGGAGACTGG - Exonic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954377286 3:50201895-50201917 CAGGGGCACCTTGAGGTTGCAGG - Intergenic
955473508 3:59312254-59312276 CAAGGGAACCCTGTGAAGGCAGG - Intergenic
955949389 3:64226870-64226892 GAGGGAAAGGTTGGGGAGGCTGG + Intronic
956488310 3:69744433-69744455 CTGGGTGACCTTGGGCAGGCTGG + Intronic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
959791436 3:110367014-110367036 CTGGGGAACTTTGGGGAAACTGG - Intergenic
960724206 3:120653899-120653921 CACTGGAACCTGGTGGAGGCAGG - Intronic
960905868 3:122600879-122600901 TAGGGGAAACTAGGGGAGGGGGG - Intronic
961059609 3:123817425-123817447 GAGGGGAACCCTGGGCAGGTAGG - Intronic
961168418 3:124779412-124779434 TAGGGGGAGGTTGGGGAGGCTGG - Intronic
961357661 3:126349290-126349312 CAGGGGACCTTGGGGGAAGCTGG + Intronic
962049366 3:131796606-131796628 AAGGGGGACCCTGGGGAGGAGGG - Intronic
963008049 3:140744554-140744576 CAGGGGCTCCTTGGGGAGATGGG - Intergenic
963981521 3:151543526-151543548 CAGGTGAACAGAGGGGAGGCAGG - Intergenic
966424823 3:179770022-179770044 CTGGGGAACGTTGGGGAAACCGG - Intronic
966593856 3:181709956-181709978 AAGGAGAACCTTCGGGGGGCAGG + Intergenic
967614637 3:191550068-191550090 TAGGGGAACATCTGGGAGGCAGG - Intergenic
968236383 3:197032415-197032437 CTGGGGAACCCTTGGAAGGCTGG + Intergenic
969329822 4:6467882-6467904 CAGGGAAACCTTGTGGTGGCTGG - Intronic
969340001 4:6534745-6534767 CAGGGCAGCCATGCGGAGGCGGG - Intronic
969849034 4:9942350-9942372 CTGGGGAACCATGGTGAGCCTGG + Intronic
970132184 4:12884446-12884468 CAGGGGCACCTGGGGCAGGAGGG - Intergenic
973712724 4:53645225-53645247 CAAGGGAACTCTCGGGAGGCTGG + Intronic
977216108 4:94285736-94285758 CTGTGGAAGCTTGGGGAGGTGGG + Intronic
979528091 4:121738476-121738498 CAGTGGACTCTTGTGGAGGCTGG + Intergenic
981121580 4:141057537-141057559 GAGGGGAAGGTTGGGGAGGTGGG - Intronic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986222030 5:5776519-5776541 CAGGGCAACCCTGGGGAGACAGG + Intergenic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
990548698 5:56850708-56850730 CATCGGAGGCTTGGGGAGGCTGG - Intronic
990973540 5:61536623-61536645 CAGGGTAACTTTGGGGACACTGG - Intronic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
995631383 5:114136547-114136569 CAGTGGAACCTGGTGGAGGGAGG + Intergenic
996726404 5:126676431-126676453 CAGGGGAAACCTGGGCATGCAGG + Intergenic
998534407 5:142915985-142916007 CTGGGGAACCTGTGGAAGGCAGG - Intronic
999937276 5:156501052-156501074 AAGGGAAACTTTGGCGAGGCTGG + Intronic
1000143033 5:158425229-158425251 CAGAGGCACCTTGGAGAGTCAGG - Intergenic
1001769053 5:174278849-174278871 GAGGGGAGCTTTGGGGAGTCTGG + Intergenic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002518693 5:179777934-179777956 CAGGGCAGCCTGGGAGAGGCTGG + Intronic
1002922792 6:1585104-1585126 CAGGGGCCCCTGGGGGAAGCCGG - Intergenic
1005914347 6:30339817-30339839 CTGTGGAACTTTGGGGAGGAGGG + Intronic
1005916665 6:30357994-30358016 CGCGGGGACCTTGGGGAGACAGG - Intergenic
1006445390 6:34076963-34076985 CAGGAGAGCCTTGGGGAGCAAGG + Intronic
1006680738 6:35795397-35795419 CACGGCACCCCTGGGGAGGCAGG - Intronic
1007163645 6:39812584-39812606 CAGGGGCAGGGTGGGGAGGCGGG - Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007708211 6:43804467-43804489 AAGGGGACACTTGGGGAGGTGGG + Intergenic
1007717396 6:43865185-43865207 CAGGGGTACCTTGCGGGGGTGGG + Intergenic
1007844430 6:44741762-44741784 GAGGGGCCCCTAGGGGAGGCTGG + Intergenic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008964257 6:57298476-57298498 GAGTGGAAGCTTGGGAAGGCTGG + Intergenic
1010523360 6:76869141-76869163 CAAGGGATCAGTGGGGAGGCAGG + Intergenic
1011603620 6:89081445-89081467 CAGGGGGCCGTTGGGGAGTCGGG + Intronic
1013091967 6:106908270-106908292 CAAGGGAGACTTGGGGAGGAGGG - Intergenic
1015450769 6:133363965-133363987 TAGGGGAACCTTGGTGAATCAGG - Intronic
1015997174 6:139007064-139007086 CAGAGGAACCTTTGGGAATCAGG + Intergenic
1017068594 6:150552075-150552097 CAGGGGGACTGTGGGGAGGGTGG + Intergenic
1018206011 6:161437558-161437580 CAGGGGAGCCTGGGCTAGGCTGG + Intronic
1019019389 6:168905003-168905025 GAGGGGAACCTAGGCGAGGCCGG - Intergenic
1019160996 6:170066738-170066760 CAGAGAAACTCTGGGGAGGCAGG - Intergenic
1019395933 7:817472-817494 CTGGGGAGCCCTGGGGAGCCGGG - Intronic
1019784535 7:2966845-2966867 GAGGGGATGCTTGGGGTGGCGGG - Intronic
1020276417 7:6627378-6627400 CAGGTGCCCCGTGGGGAGGCAGG - Intergenic
1021450398 7:20778527-20778549 GAAGGGAACTTTGGGCAGGCCGG + Intergenic
1022459538 7:30592444-30592466 CAAGGGAACTTTGTGGAGTCAGG + Intergenic
1023866648 7:44241615-44241637 CAGGGGGGCCTTGGGGGGTCTGG - Intronic
1023941199 7:44769241-44769263 CACAGGAACCTAGGGGAGGAGGG + Exonic
1024100798 7:46030733-46030755 CTGAGGAACCCTGGGGAGGGTGG + Intergenic
1025625096 7:63214077-63214099 CAGAGGAACCTTCTGGAGGGTGG + Intergenic
1026592738 7:71710997-71711019 CTGGGGACCCCTGGGGAAGCAGG - Intronic
1026971838 7:74473236-74473258 CAGGAGAACCTGGTGGGGGCAGG + Intronic
1027269506 7:76512086-76512108 GGTGGGCACCTTGGGGAGGCGGG + Intronic
1027320217 7:77005980-77006002 GGTGGGCACCTTGGGGAGGCGGG + Intergenic
1028709500 7:93890925-93890947 CAGGAGAAAGTTTGGGAGGCAGG - Exonic
1028915328 7:96252770-96252792 CAGAGGAAACTTGGGGAGAGTGG + Intronic
1029156009 7:98518517-98518539 CAGTGGAATGGTGGGGAGGCGGG - Intergenic
1032083318 7:128870609-128870631 CAAGGGCATCTTGGGAAGGCAGG + Intronic
1032192155 7:129771498-129771520 CAGGGGAGGCATGGGGATGCAGG - Intergenic
1033226398 7:139566556-139566578 AAAGGGAACCTTGGGGATTCTGG + Exonic
1034589371 7:152127037-152127059 CAGGGGTCCCTGGGGGAGGGAGG + Intergenic
1034959323 7:155355265-155355287 CTGGGTACCCTTGGGAAGGCGGG - Intergenic
1035283567 7:157792597-157792619 CAGTAGGACCTTGGGGAAGCTGG + Intronic
1036484113 8:9164170-9164192 GAGGGGACACTTGGGGAGACAGG + Intronic
1037754691 8:21703275-21703297 CAGGGGAGCCTAGGGGAGGAGGG + Intronic
1038455735 8:27671022-27671044 CAGGGGCAACCTGGAGAGGCCGG + Exonic
1039589343 8:38733739-38733761 AAGGGGAGCCTGGGAGAGGCTGG - Intronic
1044781993 8:95752701-95752723 GAGAGGGAGCTTGGGGAGGCAGG + Intergenic
1045953961 8:107885227-107885249 CTGGGGAACCTTGTGAAGGATGG + Intergenic
1046264297 8:111811482-111811504 CAGGGGAACTTTGGGAAAACAGG - Intergenic
1047325523 8:123832156-123832178 TAGGGGATCCTTGGGCAGTCTGG + Intergenic
1047850365 8:128850833-128850855 CAGGGGAGGCTTGGAGAAGCTGG + Intergenic
1048039580 8:130712716-130712738 CAGGGGAACTTTGGGGAATGAGG - Intergenic
1048573009 8:135670380-135670402 CAGTGGGACAGTGGGGAGGCTGG - Intergenic
1048906656 8:139095637-139095659 GAGGGAGGCCTTGGGGAGGCAGG + Intergenic
1049010023 8:139881143-139881165 CAGAGGAACCTCGGGAGGGCAGG - Intronic
1049184762 8:141244223-141244245 CAGGGGAACCTCCTGCAGGCAGG - Intronic
1049220914 8:141428391-141428413 CAGGGGGTCCTGGGGGAGTCTGG + Intronic
1049499243 8:142952700-142952722 GAGGGGAACCTGGGGGATGGTGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049571309 8:143371470-143371492 CAGGGGATCCTGGGGGAGAGTGG + Intronic
1049585264 8:143430073-143430095 CGGGGGCACCTCGGGGAAGCCGG - Exonic
1049600546 8:143505470-143505492 CAGGTGACCCTGGGCGAGGCAGG + Intronic
1049614992 8:143572177-143572199 CTGGGGAACCTAGGGCAGGATGG + Exonic
1049658308 8:143808568-143808590 CAGGGGAATCTGGGTCAGGCAGG + Intronic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1050596511 9:7209848-7209870 CAGGGGATCCTTGGAGATGAAGG - Intergenic
1051121458 9:13756655-13756677 CAGGGCAACTTTGGAGAAGCTGG + Intergenic
1052169053 9:25371689-25371711 CATGAGAACCTTGGGGTGGGGGG + Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057520455 9:95755623-95755645 CACGTTAACCTTGGGGAGGCAGG + Intergenic
1057702424 9:97373545-97373567 CAGGTGAACCTTGGCTGGGCTGG + Intronic
1057936008 9:99239512-99239534 CTGGGGGACCTTGGCCAGGCAGG - Intergenic
1058375327 9:104316152-104316174 CAGGAGAACCATGGGGAGCCCGG - Intergenic
1058835511 9:108855869-108855891 CAGGGTGACCCTGGAGAGGCAGG - Exonic
1059465543 9:114466848-114466870 CAGGAGACCCCTGGGGAAGCAGG - Intronic
1059465575 9:114466958-114466980 CAGGAGACCCTTGGGGAGACAGG - Intronic
1059465579 9:114466977-114466999 CAGGAGAACTCTGGGGAGGCAGG - Intronic
1059465620 9:114467128-114467150 TAGGAGACCCCTGGGGAGGCAGG - Intronic
1059932942 9:119279355-119279377 CAGGGGAACCGTGCGTGGGCAGG - Intronic
1060033757 9:120237316-120237338 CAGTGGACACGTGGGGAGGCTGG - Intergenic
1060661896 9:125409354-125409376 CAGGGGCTCCCTGGGGTGGCTGG - Intergenic
1061061756 9:128254113-128254135 GAAGGGACCCTGGGGGAGGCAGG - Intronic
1061091375 9:128428465-128428487 AAGGGGCACCGTGGGGAGGCAGG - Intronic
1061377976 9:130237230-130237252 CAGCAGGAGCTTGGGGAGGCTGG - Exonic
1061450751 9:130665887-130665909 CAGGGGAACCCTCGGGGAGCTGG + Intronic
1061709806 9:132479927-132479949 CAGTGGAACCCAGGTGAGGCTGG + Intronic
1061898025 9:133658603-133658625 CAGGGGACCCTGGGGGAAGAAGG - Exonic
1062096157 9:134705026-134705048 CAGGGGAAGATTGGGGCTGCTGG - Intronic
1186360418 X:8835747-8835769 CAGGCGAACATGGGGGAGGATGG - Intergenic
1188221683 X:27548102-27548124 CATGGGAACCGTGGGGAGCAGGG + Intergenic
1189016525 X:37290755-37290777 CAGTGGAACATTGGTGATGCTGG - Intergenic
1189229797 X:39443357-39443379 CAGGGGGACAATGGGGAGGGTGG + Intergenic
1189631627 X:42960394-42960416 CAGGAGAAATTTGGGGAGGGTGG + Intergenic
1190282610 X:48940878-48940900 CAGGGGAACCAATGGCAGGCAGG + Intronic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191255784 X:58279016-58279038 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1191256396 X:58281419-58281441 CAGGGGGAGGTTGAGGAGGCCGG - Intergenic
1194947710 X:100089337-100089359 CAGGGGAACCTCTGGGATACTGG + Intergenic
1199676792 X:150196143-150196165 CAGGGGCACCTTGGGTGGCCTGG - Intergenic
1201289563 Y:12409758-12409780 CAGAGAAACCTTGGTGAGGACGG - Intergenic