ID: 989537792

View in Genome Browser
Species Human (GRCh38)
Location 5:42583444-42583466
Sequence CACTTCCACTAGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989537792_989537796 5 Left 989537792 5:42583444-42583466 CCTGCTGCCCTCTAGTGGAAGTG 0: 1
1: 0
2: 1
3: 12
4: 181
Right 989537796 5:42583472-42583494 AAGCAGCAAAATATTTAACTGGG 0: 1
1: 0
2: 2
3: 35
4: 397
989537792_989537795 4 Left 989537792 5:42583444-42583466 CCTGCTGCCCTCTAGTGGAAGTG 0: 1
1: 0
2: 1
3: 12
4: 181
Right 989537795 5:42583471-42583493 CAAGCAGCAAAATATTTAACTGG 0: 1
1: 0
2: 1
3: 41
4: 531
989537792_989537797 14 Left 989537792 5:42583444-42583466 CCTGCTGCCCTCTAGTGGAAGTG 0: 1
1: 0
2: 1
3: 12
4: 181
Right 989537797 5:42583481-42583503 AATATTTAACTGGGAACAGCAGG 0: 1
1: 0
2: 5
3: 36
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989537792 Original CRISPR CACTTCCACTAGAGGGCAGC AGG (reversed) Intronic
901632430 1:10654410-10654432 CACTTCCACTGCAGGTAAGCGGG - Exonic
901849946 1:12008713-12008735 CACTTCCCAGAGTGGGCAGCCGG + Intronic
904566720 1:31432706-31432728 TACCTCCTCTAGAGGGCTGCTGG - Intronic
907238506 1:53067532-53067554 CACAGCCACCACAGGGCAGCAGG + Intronic
908258412 1:62320588-62320610 CACTTCCACTAGAGCTCCACTGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
915992653 1:160532320-160532342 CACTTCCCAGACAGGGCAGCCGG - Intergenic
916221779 1:162451577-162451599 CACTTCCCAGACAGGGCAGCCGG + Intergenic
917248212 1:173027687-173027709 CACTTTCTTTATAGGGCAGCAGG - Intergenic
918701640 1:187615824-187615846 CACTTCCCATTCAGGGCAGCCGG - Intergenic
1065858475 10:29850111-29850133 CACTTCCACAAAAGAGCAACTGG + Intergenic
1066419578 10:35251932-35251954 CACCTCCTCTAGAGGGCTGTAGG - Intronic
1066818732 10:39456048-39456070 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1068982827 10:63079225-63079247 CACTTAGACTAGAGTGCAGTGGG - Intergenic
1072481198 10:95810432-95810454 CACTTCCCGGATAGGGCAGCCGG + Intronic
1072534720 10:96353384-96353406 CCCTTCCACTTCAGTGCAGCTGG - Intronic
1072982339 10:100109779-100109801 CACCTCCTCCACAGGGCAGCAGG + Intergenic
1074762543 10:116677648-116677670 CACTTCCACTAAAAGGAACCAGG + Intronic
1077580420 11:3413787-3413809 CACTTCCACTGGAGTCCCGCAGG + Intergenic
1080103504 11:28486576-28486598 CACTGCCACTAGAGAGGCGCAGG - Intergenic
1080189421 11:29526453-29526475 CAGTTCCAGTAGAGGCCAGAGGG - Intergenic
1080414174 11:32054171-32054193 ATGTTCCACTAGAAGGCAGCAGG - Intronic
1080813764 11:35733563-35733585 CACTCCAACTAGAGGGAAGTAGG - Intronic
1080881648 11:36326905-36326927 GAATTCCACTAGAAGCCAGCTGG + Intronic
1084123191 11:67081621-67081643 CTCGACCACCAGAGGGCAGCAGG + Intergenic
1084237348 11:67796616-67796638 CACTTCCACTGGAGTCCCGCAGG + Intergenic
1087102707 11:94380708-94380730 TACTTCCAGAAGAGGTCAGCTGG + Exonic
1090684917 11:129105347-129105369 CACTTATCCTAGAGGTCAGCTGG - Intronic
1092408011 12:8234208-8234230 CACTTCCACTGGAGTCCTGCAGG + Intergenic
1095098843 12:38161647-38161669 CACTGCCACTCCAGGGCCGCAGG + Intergenic
1097254772 12:57665151-57665173 CACTTCCCAGACAGGGCAGCTGG - Intergenic
1100048290 12:90411374-90411396 CACTTCCAAGACGGGGCAGCAGG - Intergenic
1103904032 12:124318353-124318375 CACTTCCTCTGGAGGGAGGCCGG - Intergenic
1105267794 13:18837200-18837222 CACTTCCAAGACAGGGCAGCCGG + Intergenic
1105731809 13:23225055-23225077 CACTTCAACTAGATCCCAGCTGG + Intronic
1106724440 13:32469863-32469885 CACTTCCACTTGACTGCAGCAGG - Intronic
1107737741 13:43416562-43416584 CACTTCCCAGACAGGGCAGCCGG + Intronic
1108689131 13:52846646-52846668 CACTTGCACTAGGGCGCTGCTGG + Exonic
1111115007 13:83764357-83764379 CATTTCCACAAAAGGGAAGCTGG + Intergenic
1113736211 13:112680473-112680495 CACATCCACAGGAGGGCAGCAGG + Intronic
1114507827 14:23232133-23232155 CACTTCCCAGAGTGGGCAGCCGG - Intronic
1114628394 14:24144178-24144200 CATTTCCAAGTGAGGGCAGCTGG - Exonic
1120632053 14:86903678-86903700 AATTGCCACTAGGGGGCAGCAGG - Intergenic
1120940525 14:89943856-89943878 CACTCACACTAGAGTACAGCTGG + Intronic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1122024327 14:98864176-98864198 CTCTCCAACTACAGGGCAGCAGG + Intergenic
1124031422 15:26015856-26015878 CACCTCCACCAGCGGGAAGCTGG - Intergenic
1124706128 15:31966415-31966437 CACTTCCACTAGAGGATACAGGG + Intergenic
1125723142 15:41854657-41854679 CACATTCACTTGAGGCCAGCAGG + Intronic
1126484901 15:49169488-49169510 CACTACCACTAGAAAGCAACTGG - Intronic
1128154646 15:65384998-65385020 CAGTTCCAGCAGGGGGCAGCAGG + Exonic
1132745331 16:1433970-1433992 CTCTTCCACTGCAGGGCTGCTGG + Intergenic
1132896362 16:2231124-2231146 CATCTCCACTAGAGGCCAACAGG - Intronic
1133833914 16:9350409-9350431 CACTTCCCAGACAGGGCAGCTGG + Intergenic
1133833947 16:9350519-9350541 CACTTCCCAGACAGGGCAGCTGG + Intergenic
1137290798 16:47050650-47050672 CACATCCTCCAGATGGCAGCTGG - Intergenic
1137475385 16:48803648-48803670 CAGTGCCACTAGAAGGCACCAGG - Intergenic
1138412245 16:56849791-56849813 CAATTCCACTAGAGAGCTCCCGG - Intronic
1138442915 16:57045962-57045984 TGGTCCCACTAGAGGGCAGCCGG - Intronic
1138642558 16:58396982-58397004 CACCTCCAGGAGAGGGCGGCTGG + Intronic
1143674585 17:8422533-8422555 CCCTTCCAGGAGAGGGAAGCAGG - Intronic
1147019514 17:37520371-37520393 CATTCCCTCGAGAGGGCAGCGGG - Intronic
1147484945 17:40803787-40803809 CATTTCCACCTGAGGACAGCAGG - Intergenic
1148672143 17:49419418-49419440 CACTTCCCAGACAGGGCAGCCGG + Intronic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1154420316 18:14223197-14223219 CACTTCCCAGACAGGGCAGCTGG - Intergenic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1160478985 18:79220960-79220982 CACCTACAGTAGAGGGCAACGGG - Intronic
1162465376 19:10836325-10836347 CCCCCCCACTAGAGGGCAGGCGG + Intergenic
1164016457 19:21259715-21259737 CACTTCCCAGACAGGGCAGCCGG + Intronic
1164443723 19:28299798-28299820 CACTTCCTCCAGAGGTGAGCAGG + Intergenic
1166305518 19:41935031-41935053 CATGTCCACTAGGGGGCAGCAGG - Intergenic
926320730 2:11746822-11746844 CACTTCCCGTAGAGGGCCCCGGG - Intronic
927247923 2:20972906-20972928 CAGTTCCACCAGTTGGCAGCTGG + Intergenic
927650002 2:24906754-24906776 CACCTTCTCTGGAGGGCAGCGGG - Intronic
927737471 2:25535788-25535810 CACTTCCCATTCAGGGCAGCCGG + Intronic
930421955 2:51165345-51165367 CACCTCCACTAGAGAGGTGCTGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
933735029 2:85487973-85487995 CACCTCCCCGACAGGGCAGCTGG - Intergenic
934563157 2:95323548-95323570 CTCTTCCACCAGGGGGTAGCAGG + Intronic
934572958 2:95383731-95383753 CACCTCCTCTGGAGGCCAGCCGG + Intronic
942324382 2:174763603-174763625 GACTTCCGCTAGAGGGAAACAGG - Intronic
943125732 2:183792206-183792228 CACTTCCCAGACAGGGCAGCTGG + Intergenic
943689549 2:190855441-190855463 CTCTCTCACTAGAGGGCAGAAGG - Intergenic
943700717 2:190986037-190986059 GACGTCCACTTGAGGGCAGGTGG - Intronic
944211308 2:197209370-197209392 CACTCCCACTTGAGAGCAGTTGG - Intronic
944452435 2:199856847-199856869 CCCTGCCACTACAGGGCAGAAGG + Intergenic
944785679 2:203067065-203067087 CACTTCCCAGACAGGGCAGCCGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171415223 20:24973830-24973852 CATTTCCTCTATAGGGCAGGGGG - Intronic
1172096691 20:32463907-32463929 CACGGCCACTGGAGGCCAGCAGG + Intronic
1174618558 20:51855922-51855944 CACTTTCACTAGAGTTCAGATGG - Intergenic
1175509982 20:59517523-59517545 CACTTACGTTAGAGGGCACCTGG + Intergenic
1175816839 20:61887361-61887383 GACTGCCACTAGAGGGCAGCTGG - Intronic
1176367992 21:6045181-6045203 AGATTCCACGAGAGGGCAGCCGG - Intergenic
1176853026 21:13936305-13936327 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1176853034 21:13936342-13936364 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1179367131 21:40769024-40769046 AACTATCTCTAGAGGGCAGCTGG + Intronic
1179755527 21:43493361-43493383 AGATTCCACGAGAGGGCAGCCGG + Intergenic
1179899813 21:44384435-44384457 CCCTTCCACTGGAAGGCAGAAGG + Intronic
1180684711 22:17656681-17656703 AACTGCCAATAGAGGGCTGCAGG - Intronic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1183585886 22:38752713-38752735 CACCTCCTCTAGAGAGGAGCTGG - Intronic
1185066216 22:48632932-48632954 CAGTTCCACTAGACGGCTGCAGG + Intronic
950765176 3:15268110-15268132 CACGCCCACTAGGGGGCAGGAGG + Intronic
953532550 3:43751762-43751784 CCCGTCCACCACAGGGCAGCTGG - Intergenic
953697725 3:45172797-45172819 CTCATCCTCTAGAGGCCAGCCGG - Intergenic
954540341 3:51389521-51389543 GTGTACCACTAGAGGGCAGCAGG + Intergenic
955945910 3:64193396-64193418 CACTGCCTCTAGAGGGCATTTGG - Intronic
957053292 3:75426382-75426404 CACTTCCACTGGAGTCCCGCAGG + Intergenic
958406078 3:93760638-93760660 CACTTCCCCAAAAGGGCAGCCGG + Intergenic
958431391 3:94044416-94044438 CACTTCCCATTCAGGGCAGCCGG - Intronic
960167375 3:114418875-114418897 TTCATCCACTAGAGGGCAGTAGG - Intronic
961301534 3:125925161-125925183 CACTTCCACTGGAGTCCCGCAGG - Intergenic
961818754 3:129564582-129564604 CTCTGCCACCATAGGGCAGCTGG + Intronic
961886932 3:130102696-130102718 CACTTCCACTGGAGTCCTGCAGG + Intronic
963500170 3:146115584-146115606 CACTCCCACTAGAAGGCACAAGG + Intronic
966952269 3:184832070-184832092 CCATTACACTAGATGGCAGCAGG - Intronic
968042403 3:195599696-195599718 CACTTCCCAGACAGGGCAGCCGG + Intergenic
968996090 4:3946700-3946722 CACTTCCACTGGAGTCCTGCAGG + Intergenic
969658034 4:8509301-8509323 CACTGCCACTCCGGGGCAGCTGG - Intergenic
969757890 4:9161998-9162020 CACTTCCACTGGAGTTCTGCAGG - Intergenic
970465463 4:16318175-16318197 CACTGCAGCTAGAAGGCAGCGGG - Intergenic
972700706 4:41491370-41491392 CACTTCCCCGACAGGGCAGCCGG + Intronic
975063884 4:70037880-70037902 CACTTCCCAGACAGGGCAGCTGG - Intergenic
975641503 4:76505048-76505070 CATGTCCACAAGAGGGCACCAGG - Intronic
976455624 4:85244040-85244062 CACTTCCATTAGAGGGAGCCTGG + Intergenic
977865228 4:102017475-102017497 CACCACCACCAGAGGTCAGCTGG + Intronic
978014310 4:103723470-103723492 CACTTCCCAGACAGGGCAGCCGG - Intergenic
978273524 4:106920167-106920189 CACTTCCCCTAGGAGGTAGCAGG + Intergenic
979660193 4:123244255-123244277 CAGTCCCACCAGAGTGCAGCAGG - Intronic
982203789 4:152982090-152982112 CACCTCCACTTGATGGCAGGAGG - Intergenic
985937096 5:3105905-3105927 CACTTCCACTATATGACAGTAGG - Intergenic
986412554 5:7494936-7494958 CACATCCACAACATGGCAGCTGG - Intronic
987492135 5:18594476-18594498 CACTCCCACTATAGGCCAGGAGG - Intergenic
988532685 5:32040318-32040340 CACTTCCTAGACAGGGCAGCTGG - Intronic
989537792 5:42583444-42583466 CACTTCCACTAGAGGGCAGCAGG - Intronic
990206071 5:53430829-53430851 GAATTCCACTAGAGGGCAGTTGG - Intergenic
990616970 5:57518548-57518570 CACTTCCCATTCAGGGCAGCTGG + Intergenic
991639185 5:68736665-68736687 CAGCTCCACTACAGAGCAGCAGG + Intergenic
993318580 5:86443098-86443120 CAATTCCACTGAAGGGAAGCTGG + Intergenic
996912822 5:128675029-128675051 AACTGCCACTATGGGGCAGCAGG - Intronic
997433507 5:133857883-133857905 CACTTCCCAGACAGGGCAGCCGG + Intergenic
998675832 5:144406945-144406967 CACTTCCAATACAGGGCACCAGG + Intronic
1002595115 5:180317195-180317217 CACTACCATCAGAGGGAAGCAGG + Intronic
1005841581 6:29747821-29747843 CACCTGCACTAGAGGGGAGGGGG + Intergenic
1005870419 6:29971125-29971147 CATCTCCATTAGAGGGGAGCAGG - Intergenic
1006890852 6:37426879-37426901 CACTTCAACCAGAGGGCAAGAGG + Intergenic
1007651530 6:43425394-43425416 CACCTCCAGGACAGGGCAGCTGG - Intergenic
1008571991 6:52825363-52825385 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1009392839 6:63164294-63164316 CACTTCCCCAATGGGGCAGCCGG - Intergenic
1010946738 6:81983342-81983364 CACATTAAGTAGAGGGCAGCTGG - Intergenic
1016161259 6:140883404-140883426 CACTTCTAATAGAGTACAGCAGG - Intergenic
1016915234 6:149238295-149238317 CTCTTGCTCTAGAGGGCATCTGG + Intronic
1018091069 6:160347694-160347716 AACTTTCCCCAGAGGGCAGCCGG - Intergenic
1020320364 7:6935110-6935132 CACTTCCACTGGAGTCCCGCAGG + Intergenic
1023705881 7:42941431-42941453 CCGCTCCACTAGGGGGCAGCAGG + Intronic
1024173168 7:46810975-46810997 CTCTTCCCATACAGGGCAGCGGG + Intergenic
1025000239 7:55309840-55309862 CACTACTACCAGAGTGCAGCTGG - Intergenic
1026834162 7:73627113-73627135 CACATCCTACAGAGGGCAGCAGG - Intergenic
1029001544 7:97160063-97160085 CACTTCCCAGATAGGGCAGCCGG - Intronic
1031515314 7:122692086-122692108 CACTTCCACCTGACTGCAGCAGG + Intronic
1032874512 7:136023295-136023317 TAAGTCAACTAGAGGGCAGCTGG + Intergenic
1036848420 8:12185308-12185330 CACTTCCACTGGAGTCCTGCAGG + Intronic
1036869780 8:12427589-12427611 CACTTCCACTGGAGTCCTGCAGG + Intronic
1041853248 8:62418101-62418123 CACTTGCACTTGCTGGCAGCTGG - Intronic
1042535612 8:69855674-69855696 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1044581854 8:93833268-93833290 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1046112425 8:109741443-109741465 TACTTCCACTAATTGGCAGCAGG - Intergenic
1047247086 8:123155425-123155447 CATTTACAGTAAAGGGCAGCAGG + Intergenic
1048806890 8:138249500-138249522 CACTTTCCCTAGAGCACAGCAGG + Intronic
1049763714 8:144343210-144343232 GGCTTCCACCAGAGGGCAGCCGG + Intergenic
1049881905 8:145070664-145070686 CATTTCCAGTATAGGCCAGCGGG + Intergenic
1052744818 9:32430271-32430293 CTCTCCCACTAGAGGGGAGAAGG - Intronic
1055977838 9:81971956-81971978 CAGGCTCACTAGAGGGCAGCAGG - Intergenic
1057758694 9:97855677-97855699 CTGTTACACTAGAGGGCTGCAGG + Exonic
1059443893 9:114326277-114326299 CACTTATCCTAGAAGGCAGCGGG - Exonic
1059445100 9:114333054-114333076 CACTTATCCTAGAAGGCAGCGGG - Exonic
1060053695 9:120394833-120394855 CACTTCCACCAGAGGTCACGAGG - Intronic
1062457378 9:136646065-136646087 CATATCCACCAGAGGGCAGCTGG + Intergenic
1188715664 X:33456708-33456730 CACTGCCACTAGAGGCCCACAGG - Intergenic
1189201807 X:39202767-39202789 GCCTGCAACTAGAGGGCAGCTGG - Intergenic
1189206532 X:39244298-39244320 CAGTTCTACTACAGGACAGCCGG - Intergenic
1189352733 X:40288941-40288963 CACTTCAACTAGGGGGAAGGAGG - Intergenic
1189516769 X:41720330-41720352 CACTTCCTGGAGAGGGCAGGGGG + Intronic
1192664022 X:73069362-73069384 CACTTCCCAGATAGGGCAGCCGG - Intergenic
1192664100 X:73069626-73069648 CACTTCCCCGACGGGGCAGCTGG - Intergenic
1195324434 X:103746897-103746919 CACTTCACCCAGAAGGCAGCTGG - Intergenic
1197115864 X:122833020-122833042 TACTTCTATTACAGGGCAGCAGG - Intergenic
1199285449 X:146049767-146049789 CACTTCCCAGACAGGGCAGCCGG - Intergenic
1199651505 X:149949332-149949354 CTATTCCAATAAAGGGCAGCTGG - Intergenic
1199980022 X:152915794-152915816 CAGTTCCTCCAGAGGCCAGCAGG - Intronic
1201294748 Y:12453622-12453644 CACTTCCCAGACAGGGCAGCCGG + Intergenic
1201585790 Y:15559672-15559694 CACTTACACTGGAGTCCAGCTGG - Intergenic
1202045771 Y:20736070-20736092 CTCTTCCTCTCCAGGGCAGCAGG - Intergenic