ID: 989543462

View in Genome Browser
Species Human (GRCh38)
Location 5:42645133-42645155
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989543459_989543462 23 Left 989543459 5:42645087-42645109 CCAGAAAATATTTGAGTTCTAGC 0: 1
1: 0
2: 0
3: 13
4: 189
Right 989543462 5:42645133-42645155 GCTGAAGTATGTGGTCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr