ID: 989544614

View in Genome Browser
Species Human (GRCh38)
Location 5:42658837-42658859
Sequence GACTCCCTAGGCTTTATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989544614_989544620 23 Left 989544614 5:42658837-42658859 CCTACCATAAAGCCTAGGGAGTC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 989544620 5:42658883-42658905 TTTATATTTAAGAGTGGATGTGG No data
989544614_989544619 17 Left 989544614 5:42658837-42658859 CCTACCATAAAGCCTAGGGAGTC 0: 1
1: 0
2: 1
3: 6
4: 85
Right 989544619 5:42658877-42658899 ATTTGTTTTATATTTAAGAGTGG 0: 1
1: 1
2: 2
3: 100
4: 1327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989544614 Original CRISPR GACTCCCTAGGCTTTATGGT AGG (reversed) Intronic
900646071 1:3709239-3709261 GACTCGCTGGGCTTGATGGGAGG + Intronic
900718529 1:4160366-4160388 GACAGCCTGGGCTTTGTGGTGGG + Intergenic
902724485 1:18325714-18325736 GCCTCCCTAGACCTTGTGGTGGG - Intronic
903184088 1:21619690-21619712 GACACCGCAGGCTTTGTGGTGGG - Intronic
903569896 1:24296670-24296692 AACTCCCTGGGCTTTCTGGACGG - Intergenic
903759398 1:25687299-25687321 GACTCCCAAGGCTCTAGGTTAGG - Intronic
908489271 1:64626724-64626746 GACCCTCTAGGCATTATGCTAGG - Intronic
918614898 1:186532679-186532701 GACCCCCTAGACTTTATGTATGG - Intergenic
1066691246 10:38030776-38030798 GACCACCTAGGCTTTATTATTGG + Intronic
1067001454 10:42617892-42617914 GACCACCTAGGCTTTATTATTGG - Intronic
1071857294 10:89638658-89638680 TACACCCTAGGCTTTATGGAAGG - Intronic
1078546657 11:12252102-12252124 GACTTCCTGGGCTTTGTGGGAGG - Intronic
1087770559 11:102205168-102205190 TACTACCTAGGCTTTGTGCTGGG + Intronic
1092370500 12:7913130-7913152 GACTACCTAGACTTTATCTTGGG + Intergenic
1092551468 12:9506413-9506435 GACTCCTGAAGATTTATGGTTGG - Intergenic
1100905798 12:99297694-99297716 CAATACCTAGGCTTCATGGTGGG + Intronic
1102813491 12:115843853-115843875 TCCTCCCTAGGGTTTTTGGTGGG + Intergenic
1106372828 13:29153249-29153271 GTCTCTCTAGGCCTGATGGTAGG - Intronic
1110247911 13:73347998-73348020 TACTCTCAAGGCTGTATGGTAGG - Intergenic
1118072141 14:62256997-62257019 GCCTCTCTTGGCTTTATTGTGGG + Intergenic
1121017248 14:90556254-90556276 GACTGCCCAGGCTTCAGGGTAGG - Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121805785 14:96820967-96820989 AACTCTCTAGGGTTCATGGTAGG - Intronic
1123948366 15:25249842-25249864 GACTGCCCAGGCTTCATGATGGG + Intergenic
1124602834 15:31149196-31149218 GACTCTATTGGCTTTAGGGTGGG + Intronic
1127959346 15:63879352-63879374 GTTTCCCCAGCCTTTATGGTTGG - Intergenic
1133502622 16:6380046-6380068 AAGTCCGTAGGCTTTATGGCGGG + Intronic
1137590381 16:49689817-49689839 GACTGCCTTGGTTTTTTGGTCGG - Intronic
1146558052 17:33843904-33843926 GACTCCCAAGGCTTAATGGTTGG - Intronic
1147391366 17:40111462-40111484 GACTTCCTGGGCTTTGGGGTGGG - Intergenic
1149075071 17:52586935-52586957 GATTCCCTAGGGTTGCTGGTGGG - Intergenic
1151511018 17:74560155-74560177 GATTTCCTAGGCTGAATGGTGGG + Intergenic
1156323387 18:36049435-36049457 AACTCCCTAAGTTTTTTGGTGGG - Intronic
1160037586 18:75316089-75316111 GACTCTGTAGGGTTTATGGAGGG + Intergenic
1167298654 19:48666586-48666608 TCCTCCCTAGGCTTTCTGATGGG + Intronic
928312123 2:30219912-30219934 AACTCCCTATGGTGTATGGTAGG - Intergenic
930277213 2:49325867-49325889 AATTCCCTAGGATATATGGTTGG - Intergenic
931005833 2:57849652-57849674 GCCTTCCCAGGCTTTAGGGTGGG + Intergenic
933352375 2:81170518-81170540 GACTCACTTGGCTTTAGGGAGGG + Intergenic
933757203 2:85649141-85649163 GAATCCCAAGGCTTGATGTTTGG - Exonic
934033585 2:88069209-88069231 GATAACCTAGGCTTTGTGGTTGG + Intronic
947691551 2:232141537-232141559 GATTGCCTAGGCTTAATGGGAGG + Intronic
948177172 2:235953089-235953111 GACTCCCAAGCCTTTATTGGAGG - Intronic
1170204419 20:13783430-13783452 GAATCCCAGGGCTTTATGGAGGG + Intronic
1171230558 20:23480758-23480780 GACTCCCTAGCCCTTCTGTTCGG - Intergenic
1173250818 20:41363479-41363501 AACTCCCTCAGCTTTATGGTGGG + Intronic
1173940197 20:46904471-46904493 GACTCCCTGGCCTTTAAGCTTGG - Intronic
1174362092 20:50035220-50035242 GCCTCCTTAGGCTTAATGGGTGG + Intergenic
1182051961 22:27319468-27319490 GAATCCTTAGGCTATAGGGTAGG + Intergenic
952446182 3:33383271-33383293 GCCTCTCTAGTTTTTATGGTGGG + Intronic
953145325 3:40269648-40269670 GAATTCCTAGGCTTTTTGGAAGG - Intergenic
964511182 3:157453674-157453696 GACTCCTCAGGCTGTCTGGTAGG + Intronic
965186075 3:165466116-165466138 GACTCCCTAGGCCTTTTGGGAGG + Intergenic
965456654 3:168909818-168909840 GACTCACTATCCTTTATGCTGGG - Intergenic
966975571 3:185080462-185080484 GACTCCATTGGCTTAGTGGTGGG + Exonic
975037192 4:69698579-69698601 GACACCCAAGTCTTTTTGGTGGG + Intergenic
978489635 4:109298870-109298892 GATTTCCTAGGCTTTTTTGTTGG - Intronic
989544614 5:42658837-42658859 GACTCCCTAGGCTTTATGGTAGG - Intronic
993021418 5:82595967-82595989 GACTCCCCAGGCTTCATCCTCGG + Intergenic
994305007 5:98192466-98192488 GAATCCTTAGCCATTATGGTGGG - Intergenic
995298717 5:110552834-110552856 TATTCCCTAGGCTTTCTGCTAGG + Intronic
1000953161 5:167509884-167509906 GACTCCCAAGCCCATATGGTGGG + Intronic
1005501404 6:26431854-26431876 GACTCCTTAGCTGTTATGGTGGG - Intergenic
1012741243 6:103018722-103018744 GCCTCCCTTGGCTTGAGGGTGGG + Intergenic
1015913045 6:138187454-138187476 GACACCCTGGGCTTTCAGGTGGG + Intronic
1018031652 6:159846001-159846023 AACTCCCTAGGCTTTCAGCTGGG + Intergenic
1023433224 7:40115857-40115879 GAAGCCCTAGGCTTTGTTGTAGG + Intergenic
1023492415 7:40758129-40758151 GAGTTGCTTGGCTTTATGGTTGG + Intronic
1023899042 7:44460982-44461004 GACTACCTAGGATATGTGGTAGG - Intronic
1026612895 7:71876045-71876067 GACTCCCTCTGCTTCATGGTAGG + Intronic
1028796134 7:94907085-94907107 TGCTCCCTAGGCTTTTTGGAAGG + Intergenic
1028798575 7:94933791-94933813 GACTACCTAGGCTGCATGCTGGG - Intronic
1030671965 7:112347829-112347851 GAATCCCTAGGCGTATTGGTTGG - Intergenic
1031204798 7:118743003-118743025 GACCCACTAAGCTTCATGGTAGG + Intergenic
1038274488 8:26109185-26109207 GAATCTCTAGGGTTTTTGGTAGG + Intergenic
1042226469 8:66518792-66518814 GACCCCCTGGGGCTTATGGTGGG - Intergenic
1044504906 8:93006356-93006378 GCCTCCCTTGGCTTTGGGGTGGG - Intronic
1047679852 8:127243396-127243418 GACTCCCTAGGCTTTTTCTGAGG + Intergenic
1048246055 8:132801227-132801249 GACTCACTAGTGTTAATGGTTGG + Intronic
1048338195 8:133518642-133518664 GACTCCCTAGGCTTGGAGGCTGG + Intronic
1050535577 9:6627819-6627841 CACTCACTAGGCTGTATGTTTGG - Intronic
1052933200 9:34072525-34072547 GACTCCTTTGGCTTTAGGGTAGG - Intergenic
1053442245 9:38126082-38126104 CACACCCTAGGCTATAAGGTAGG - Intergenic
1057033692 9:91797588-91797610 GACACCCTAGGCTCTGTGGGTGG + Intronic
1057033888 9:91798267-91798289 GACACCCTAGGCTCTGTGGGTGG + Intronic
1059377261 9:113893225-113893247 GACTCCATAGGCTTTGGGGTTGG - Intronic
1059632844 9:116142964-116142986 GACTCCCTGGAGGTTATGGTAGG - Intergenic
1062729981 9:138103345-138103367 GACTTTCTAGGCTCCATGGTGGG + Intronic
1191774286 X:64795763-64795785 GGCTGCCTATGCTTTATTGTAGG - Intergenic
1193590536 X:83384099-83384121 GACTCCCTGGGCTTTCTTGGGGG - Intergenic
1196685296 X:118505422-118505444 TCATCCCCAGGCTTTATGGTGGG + Intronic
1197099740 X:122637957-122637979 GGCTGCCTAGGCTTTTTGGATGG - Intergenic
1199592434 X:149479934-149479956 GACTCTCTAGACTCTATTGTGGG - Intergenic