ID: 989545337

View in Genome Browser
Species Human (GRCh38)
Location 5:42665960-42665982
Sequence GGTAATTGAATCATGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10841
Summary {0: 1279, 1: 2403, 2: 2809, 3: 2464, 4: 1886}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545337_989545349 16 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545349 5:42665999-42666021 TCATGACACATGCGGATTATGGG No data
989545337_989545345 8 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545337_989545350 19 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545337_989545348 15 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545337 Original CRISPR GGTAATTGAATCATGGGGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr