ID: 989545338

View in Genome Browser
Species Human (GRCh38)
Location 5:42665964-42665986
Sequence GGAAGGTAATTGAATCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29469
Summary {0: 184, 1: 3372, 2: 6558, 3: 9434, 4: 9921}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545338_989545349 12 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545349 5:42665999-42666021 TCATGACACATGCGGATTATGGG No data
989545338_989545345 4 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545338_989545348 11 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545338_989545350 15 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545338 Original CRISPR GGAAGGTAATTGAATCATGG GGG (reversed) Intronic
Too many off-targets to display for this crispr