ID: 989545340

View in Genome Browser
Species Human (GRCh38)
Location 5:42665966-42665988
Sequence GTGGAAGGTAATTGAATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30112
Summary {0: 166, 1: 3359, 2: 6675, 3: 9465, 4: 10447}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545340_989545350 13 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545340_989545348 9 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545340_989545345 2 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545340_989545349 10 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545349 5:42665999-42666021 TCATGACACATGCGGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545340 Original CRISPR GTGGAAGGTAATTGAATCAT GGG (reversed) Intronic
Too many off-targets to display for this crispr