ID: 989545341

View in Genome Browser
Species Human (GRCh38)
Location 5:42665967-42665989
Sequence GGTGGAAGGTAATTGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28040
Summary {0: 109, 1: 2008, 2: 5532, 3: 9528, 4: 10863}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545341_989545348 8 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545341_989545349 9 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545349 5:42665999-42666021 TCATGACACATGCGGATTATGGG No data
989545341_989545345 1 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545341_989545350 12 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545341 Original CRISPR GGTGGAAGGTAATTGAATCA TGG (reversed) Intronic
Too many off-targets to display for this crispr