ID: 989545342

View in Genome Browser
Species Human (GRCh38)
Location 5:42665981-42666003
Sequence CATGAGAGGGAGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3184
Summary {0: 2, 1: 5, 2: 98, 3: 701, 4: 2378}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545342_989545351 24 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545351 5:42666028-42666050 AATTCAAGATGTGATTTGTATGG 0: 1
1: 16
2: 917
3: 10071
4: 14054
989545342_989545353 26 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545342_989545348 -6 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545342_989545352 25 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545352 5:42666029-42666051 ATTCAAGATGTGATTTGTATGGG 0: 1
1: 16
2: 863
3: 9855
4: 12207
989545342_989545350 -2 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545342_989545349 -5 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545349 5:42665999-42666021 TCATGACACATGCGGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545342 Original CRISPR CATGAGAGGGAGCTGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr