ID: 989545344

View in Genome Browser
Species Human (GRCh38)
Location 5:42665988-42666010
Sequence CATGTGTCATGAGAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4503
Summary {0: 1, 1: 33, 2: 420, 3: 1135, 4: 2914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545344_989545352 18 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545352 5:42666029-42666051 ATTCAAGATGTGATTTGTATGGG 0: 1
1: 16
2: 863
3: 9855
4: 12207
989545344_989545350 -9 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545344_989545351 17 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545351 5:42666028-42666050 AATTCAAGATGTGATTTGTATGG 0: 1
1: 16
2: 917
3: 10071
4: 14054
989545344_989545353 19 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545344 Original CRISPR CATGTGTCATGAGAGGGAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr