ID: 989545345

View in Genome Browser
Species Human (GRCh38)
Location 5:42665991-42666013
Sequence GCTCCCTCTCATGACACATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545340_989545345 2 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545339_989545345 3 Left 989545339 5:42665965-42665987 CCCCATGATTCAATTACCTTCCA 0: 178
1: 3381
2: 6698
3: 9592
4: 11032
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545338_989545345 4 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545341_989545345 1 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data
989545337_989545345 8 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545345 5:42665991-42666013 GCTCCCTCTCATGACACATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545345 Original CRISPR GCTCCCTCTCATGACACATG CGG Intronic
No off target data available for this crispr