ID: 989545346

View in Genome Browser
Species Human (GRCh38)
Location 5:42665994-42666016
Sequence AATCCGCATGTGTCATGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5849
Summary {0: 2, 1: 51, 2: 645, 3: 1637, 4: 3514}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545346_989545353 13 Left 989545346 5:42665994-42666016 CCCTCTCATGACACATGCGGATT 0: 2
1: 51
2: 645
3: 1637
4: 3514
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545346_989545351 11 Left 989545346 5:42665994-42666016 CCCTCTCATGACACATGCGGATT 0: 2
1: 51
2: 645
3: 1637
4: 3514
Right 989545351 5:42666028-42666050 AATTCAAGATGTGATTTGTATGG 0: 1
1: 16
2: 917
3: 10071
4: 14054
989545346_989545352 12 Left 989545346 5:42665994-42666016 CCCTCTCATGACACATGCGGATT 0: 2
1: 51
2: 645
3: 1637
4: 3514
Right 989545352 5:42666029-42666051 ATTCAAGATGTGATTTGTATGGG 0: 1
1: 16
2: 863
3: 9855
4: 12207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545346 Original CRISPR AATCCGCATGTGTCATGAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr