ID: 989545347

View in Genome Browser
Species Human (GRCh38)
Location 5:42665995-42666017
Sequence TAATCCGCATGTGTCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6156
Summary {0: 2, 1: 54, 2: 642, 3: 1884, 4: 3574}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545347_989545353 12 Left 989545347 5:42665995-42666017 CCTCTCATGACACATGCGGATTA 0: 2
1: 54
2: 642
3: 1884
4: 3574
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545347_989545352 11 Left 989545347 5:42665995-42666017 CCTCTCATGACACATGCGGATTA 0: 2
1: 54
2: 642
3: 1884
4: 3574
Right 989545352 5:42666029-42666051 ATTCAAGATGTGATTTGTATGGG 0: 1
1: 16
2: 863
3: 9855
4: 12207
989545347_989545351 10 Left 989545347 5:42665995-42666017 CCTCTCATGACACATGCGGATTA 0: 2
1: 54
2: 642
3: 1884
4: 3574
Right 989545351 5:42666028-42666050 AATTCAAGATGTGATTTGTATGG 0: 1
1: 16
2: 917
3: 10071
4: 14054

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545347 Original CRISPR TAATCCGCATGTGTCATGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr