ID: 989545348

View in Genome Browser
Species Human (GRCh38)
Location 5:42665998-42666020
Sequence CTCATGACACATGCGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5035
Summary {0: 2, 1: 47, 2: 581, 3: 1510, 4: 2895}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545340_989545348 9 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545343_989545348 -10 Left 989545343 5:42665985-42666007 CCACCAGCTCCCTCTCATGACAC 0: 1
1: 36
2: 430
3: 1400
4: 3824
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545342_989545348 -6 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545338_989545348 11 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545341_989545348 8 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545337_989545348 15 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895
989545339_989545348 10 Left 989545339 5:42665965-42665987 CCCCATGATTCAATTACCTTCCA 0: 178
1: 3381
2: 6698
3: 9592
4: 11032
Right 989545348 5:42665998-42666020 CTCATGACACATGCGGATTATGG 0: 2
1: 47
2: 581
3: 1510
4: 2895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545348 Original CRISPR CTCATGACACATGCGGATTA TGG Intronic
Too many off-targets to display for this crispr