ID: 989545350

View in Genome Browser
Species Human (GRCh38)
Location 5:42666002-42666024
Sequence TGACACATGCGGATTATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 2, 2: 1, 3: 17, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545343_989545350 -6 Left 989545343 5:42665985-42666007 CCACCAGCTCCCTCTCATGACAC 0: 1
1: 36
2: 430
3: 1400
4: 3824
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545338_989545350 15 Left 989545338 5:42665964-42665986 CCCCCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545340_989545350 13 Left 989545340 5:42665966-42665988 CCCATGATTCAATTACCTTCCAC 0: 166
1: 3359
2: 6675
3: 9465
4: 10447
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545339_989545350 14 Left 989545339 5:42665965-42665987 CCCCATGATTCAATTACCTTCCA 0: 178
1: 3381
2: 6698
3: 9592
4: 11032
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545337_989545350 19 Left 989545337 5:42665960-42665982 CCTGCCCCCATGATTCAATTACC 0: 1279
1: 2403
2: 2809
3: 2464
4: 1886
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545341_989545350 12 Left 989545341 5:42665967-42665989 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545342_989545350 -2 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84
989545344_989545350 -9 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG 0: 1
1: 2
2: 1
3: 17
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545350 Original CRISPR TGACACATGCGGATTATGGG AGG Intronic
900098281 1:949276-949298 GGACAGAAGCAGATTATGGGGGG + Intronic
900728530 1:4235490-4235512 CAACACATGGGAATTATGGGAGG - Intergenic
900848011 1:5119000-5119022 CAACACATGGGAATTATGGGCGG + Intergenic
901134620 1:6984915-6984937 TCACACATTCGGACTGTGGGAGG + Intronic
902381695 1:16055782-16055804 TGACACATGAGGCCTCTGGGTGG + Intronic
906397432 1:45478954-45478976 TGAGACAGGCGGATTATGTGAGG - Intronic
911628650 1:100157194-100157216 CAACACATGGGAATTATGGGAGG - Intronic
915151532 1:153836192-153836214 TGACACAAGAGGATCATTGGAGG + Intronic
916318621 1:163478527-163478549 TGACACATGGGAATTGTGGGAGG - Intergenic
922543114 1:226433841-226433863 CTACACAAGGGGATTATGGGAGG + Intergenic
1063809094 10:9682456-9682478 TGACATGTGCGAATTGTGGGAGG - Intergenic
1066586478 10:36942100-36942122 TGACACATGGGGATTATGGGAGG + Intergenic
1067572597 10:47382565-47382587 CAACATATGCGGATTCTGGGGGG - Intronic
1068717206 10:60201510-60201532 TGCCACATGCAGATCATGGGTGG + Intronic
1069400429 10:68039016-68039038 TGCCAGATGCGGATTACAGGTGG + Intronic
1073840499 10:107493893-107493915 TAACACATGCTAATTATGGCTGG - Intergenic
1075718975 10:124574104-124574126 TGACACATGTGGTCTATGGGAGG - Intronic
1075769829 10:124923847-124923869 TGACACATGGGGATTACAGTTGG + Intergenic
1077784709 11:5370843-5370865 TGACAAATGCGGGTTCTGAGAGG + Intronic
1079769323 11:24438790-24438812 CAACACATGGGAATTATGGGAGG + Intergenic
1079828184 11:25225791-25225813 TGACACATGGGGATTATGGGAGG + Intergenic
1081166982 11:39819376-39819398 TGACATATGGGGATTATAGGAGG + Intergenic
1082686394 11:56243813-56243835 TGACGTGTGGGGATTATGGGTGG - Intergenic
1084159871 11:67341647-67341669 CGACACAGGTGGATTATGCGAGG + Intronic
1085875865 11:80405428-80405450 TGACACATGGGAATTATGAGAGG - Intergenic
1086376603 11:86207053-86207075 TAACACATCCGCATTCTGGGAGG + Intergenic
1098067717 12:66636980-66637002 TGTCACATGCTGCTGATGGGAGG + Intronic
1099700190 12:86073992-86074014 TGACACATGAAAATTCTGGGAGG - Intronic
1100222599 12:92522153-92522175 TGACATGTGGGGATTATGGGAGG - Intergenic
1105789887 13:23788126-23788148 TCACACACGTGGATTAAGGGTGG - Intronic
1107198545 13:37684148-37684170 TGACAAATTCAGATTATGGTTGG - Intronic
1111199426 13:84914464-84914486 TGACACTTAGGGATTATGAGAGG + Intergenic
1117061377 14:51966967-51966989 AGAAACATGAGGATTTTGGGGGG - Exonic
1117090342 14:52243881-52243903 TGACACATGGGGATTACAGGGGG + Intergenic
1124031436 15:26015936-26015958 TCACACATGCTGACTAAGGGAGG + Intergenic
1127549569 15:60023563-60023585 TGACATCTGAGGATTATGTGAGG - Intronic
1127966909 15:63929429-63929451 TAACACATCTGGATTATGGTGGG + Intronic
1128111927 15:65081927-65081949 TGACACATGCTGACTGTGGGTGG - Intergenic
1138297717 16:55901060-55901082 TGACACGTGGGAATTATGGGAGG - Intronic
1139429712 16:66904609-66904631 TGACACATGGGGGTGATGGAGGG + Intergenic
1155599652 18:27530992-27531014 CAACACATGGGAATTATGGGAGG - Intergenic
1159956147 18:74519713-74519735 AGAAACAAGCGGATAATGGGAGG + Intronic
926406065 2:12554239-12554261 TTCCACATGCGGATTTTAGGGGG + Intergenic
928749722 2:34457656-34457678 TAACACATAGGAATTATGGGAGG + Intergenic
930390946 2:50761289-50761311 CCACTCATGAGGATTATGGGAGG - Intronic
933457881 2:82540210-82540232 TGACACTTACGAAATATGGGAGG + Intergenic
935871463 2:107455372-107455394 TGCCACATGCAGATACTGGGAGG + Intergenic
942417865 2:175777665-175777687 CAACACATGGGAATTATGGGAGG + Intergenic
942926030 2:181433694-181433716 TGACACTTGGGAATTATGGGAGG - Intergenic
944473295 2:200078629-200078651 TGACAAATGCAGAGTATTGGGGG - Intergenic
946763537 2:223019292-223019314 TGACATGTGGGGATTATGGGAGG + Intergenic
1169338318 20:4775928-4775950 TAACACAAGCGGCTTATGGACGG - Intergenic
1169746089 20:8944732-8944754 TGACACATATGGATTATTGATGG - Intronic
1171155234 20:22865967-22865989 TCAAACATGTGGATGATGGGTGG + Intergenic
1171773880 20:29348129-29348151 CGACACAGGAGAATTATGGGAGG + Intergenic
1171902484 20:30870356-30870378 CGACACAGGAGAATTATGGGAGG - Intergenic
1173841045 20:46157582-46157604 TGACAAATGCGGGAGATGGGGGG - Intergenic
1185195807 22:49468907-49468929 TGACTCATGTGGTTTATAGGTGG - Intronic
951916027 3:27801620-27801642 AGACACATGCAGATCATTGGGGG + Intergenic
955222788 3:57037133-57037155 TGAGACATGTGCATTATGGAGGG + Intronic
955621028 3:60864201-60864223 TGACATGTGGGGATTATGGTAGG + Intronic
963704592 3:148670144-148670166 TGACACATGAAGAATAAGGGAGG + Intergenic
964190071 3:153991473-153991495 TAACACCTGGGAATTATGGGAGG - Intergenic
970541903 4:17088613-17088635 CAACACATGGGAATTATGGGAGG - Intergenic
971580438 4:28331799-28331821 TAACACATGAGGATTCTGAGAGG + Intergenic
974499274 4:62677843-62677865 TTACACATGGGAATTATGGGAGG - Intergenic
976987153 4:91315928-91315950 TGACATGTGGTGATTATGGGAGG - Intronic
982390071 4:154853994-154854016 TGACACTTGGAAATTATGGGAGG + Intergenic
985281103 4:188286052-188286074 TGACGCAGGCGGATTATCTGAGG + Intergenic
986967025 5:13286392-13286414 TGACACGTGGTAATTATGGGAGG - Intergenic
989445894 5:41527817-41527839 CAACACATGGGAATTATGGGAGG - Intergenic
989545350 5:42666002-42666024 TGACACATGCGGATTATGGGAGG + Intronic
994415849 5:99469287-99469309 TGTCACATTCGGACTATGGAAGG + Intergenic
994418880 5:99508020-99508042 TGATACCTGTGGAATATGGGAGG + Intergenic
994464121 5:100105829-100105851 TGTCACATTCGGACTATGGAAGG - Intergenic
998057797 5:139093888-139093910 TGACAGATGTGGAGTATGTGTGG - Intronic
1006778238 6:36613242-36613264 CGACACATGCGATTCATGGGAGG + Intergenic
1007430784 6:41775582-41775604 TGACAAATGTGGATGATGAGGGG - Exonic
1009738223 6:67706885-67706907 TGACACGTAGGGATTTTGGGAGG + Intergenic
1010310758 6:74382809-74382831 GGACACATGCTACTTATGGGTGG - Intergenic
1012691501 6:102318912-102318934 TAACACATGGGAATTATGGGAGG - Intergenic
1013063938 6:106664618-106664640 TGACAAATCCTGATTATGGATGG - Intronic
1015446183 6:133307885-133307907 CAACACACGGGGATTATGGGAGG - Intronic
1016242788 6:141951932-141951954 TGACACATGGGGATTATAGTTGG - Intergenic
1016485458 6:144532552-144532574 TGGCATGTGGGGATTATGGGAGG + Intronic
1016747433 6:147595856-147595878 TGAAACATGAGGAATATGGATGG - Intronic
1019703705 7:2487628-2487650 TGCCCCATGAGGATTAGGGGTGG - Intergenic
1019941490 7:4295449-4295471 CAACACATGGGAATTATGGGAGG + Intergenic
1022605590 7:31811065-31811087 CAACACATGGGAATTATGGGAGG - Intronic
1028715178 7:93957408-93957430 TGACATGTGGGAATTATGGGGGG - Intergenic
1032389794 7:131548472-131548494 TGTCACATGTGGTTTCTGGGAGG + Intronic
1036010917 8:4722173-4722195 ACACACATGCTGACTATGGGAGG + Intronic
1043083339 8:75794429-75794451 TGACACATGGGGCTTAGGAGAGG + Intergenic
1043385851 8:79747298-79747320 TGACACGTGGGAATTGTGGGAGG + Intergenic
1051424555 9:16920195-16920217 CAACACATGGGAATTATGGGAGG + Intergenic
1055627973 9:78194087-78194109 GGACACATGGGAATTATGGGAGG + Intergenic
1058307624 9:103463329-103463351 TGACACGTGGGGATTATGGGAGG + Intergenic
1059684150 9:116618525-116618547 TGACACATGCGGATTCTTTTGGG - Intronic
1060830210 9:126709021-126709043 TGACACATGGAGATTAAGGGAGG - Intergenic
1185837721 X:3360774-3360796 TAACACAAGCCGCTTATGGGTGG - Intergenic
1187270234 X:17773908-17773930 GGACAGATGCAGATTACGGGTGG - Intergenic
1189903455 X:45733470-45733492 TGACACATGGGGATTATAATTGG - Intergenic
1194548684 X:95270052-95270074 TGACAGGTGGGAATTATGGGAGG + Intergenic
1195640703 X:107171657-107171679 CAACACATGGGAATTATGGGAGG + Intronic
1199186469 X:144921288-144921310 TAACATGTGGGGATTATGGGAGG - Intergenic