ID: 989545353

View in Genome Browser
Species Human (GRCh38)
Location 5:42666030-42666052
Sequence TTCAAGATGTGATTTGTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23225
Summary {0: 1, 1: 12, 2: 828, 3: 9875, 4: 12509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989545342_989545353 26 Left 989545342 5:42665981-42666003 CCTTCCACCAGCTCCCTCTCATG 0: 2
1: 5
2: 98
3: 701
4: 2378
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545347_989545353 12 Left 989545347 5:42665995-42666017 CCTCTCATGACACATGCGGATTA 0: 2
1: 54
2: 642
3: 1884
4: 3574
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545343_989545353 22 Left 989545343 5:42665985-42666007 CCACCAGCTCCCTCTCATGACAC 0: 1
1: 36
2: 430
3: 1400
4: 3824
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545344_989545353 19 Left 989545344 5:42665988-42666010 CCAGCTCCCTCTCATGACACATG 0: 1
1: 33
2: 420
3: 1135
4: 2914
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509
989545346_989545353 13 Left 989545346 5:42665994-42666016 CCCTCTCATGACACATGCGGATT 0: 2
1: 51
2: 645
3: 1637
4: 3514
Right 989545353 5:42666030-42666052 TTCAAGATGTGATTTGTATGGGG 0: 1
1: 12
2: 828
3: 9875
4: 12509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989545353 Original CRISPR TTCAAGATGTGATTTGTATG GGG Intronic
Too many off-targets to display for this crispr