ID: 989550000

View in Genome Browser
Species Human (GRCh38)
Location 5:42723479-42723501
Sequence CAGTCTACTCAGAGGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989550000_989550004 -10 Left 989550000 5:42723479-42723501 CCTACATCCCTCTGAGTAGACTG No data
Right 989550004 5:42723492-42723514 GAGTAGACTGGAACCAAGTATGG No data
989550000_989550005 -1 Left 989550000 5:42723479-42723501 CCTACATCCCTCTGAGTAGACTG No data
Right 989550005 5:42723501-42723523 GGAACCAAGTATGGTGAATCTGG No data
989550000_989550006 0 Left 989550000 5:42723479-42723501 CCTACATCCCTCTGAGTAGACTG No data
Right 989550006 5:42723502-42723524 GAACCAAGTATGGTGAATCTGGG No data
989550000_989550009 10 Left 989550000 5:42723479-42723501 CCTACATCCCTCTGAGTAGACTG No data
Right 989550009 5:42723512-42723534 TGGTGAATCTGGGGAATGTGTGG No data
989550000_989550007 1 Left 989550000 5:42723479-42723501 CCTACATCCCTCTGAGTAGACTG No data
Right 989550007 5:42723503-42723525 AACCAAGTATGGTGAATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989550000 Original CRISPR CAGTCTACTCAGAGGGATGT AGG (reversed) Intergenic
No off target data available for this crispr