ID: 989552563

View in Genome Browser
Species Human (GRCh38)
Location 5:42752785-42752807
Sequence CACAGCTAACATTTTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989552556_989552563 -5 Left 989552556 5:42752767-42752789 CCATCATGCCCAGCCACCCACAG No data
Right 989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG No data
989552555_989552563 22 Left 989552555 5:42752740-42752762 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG No data
989552554_989552563 23 Left 989552554 5:42752739-42752761 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG No data
989552552_989552563 26 Left 989552552 5:42752736-42752758 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989552563 Original CRISPR CACAGCTAACATTTTGATGG AGG Intergenic
No off target data available for this crispr