ID: 989553525

View in Genome Browser
Species Human (GRCh38)
Location 5:42764037-42764059
Sequence ATTAGTAATAGGGAAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989553525_989553530 -6 Left 989553525 5:42764037-42764059 CCCACCACTTCCCTATTACTAAT 0: 1
1: 0
2: 1
3: 5
4: 172
Right 989553530 5:42764054-42764076 ACTAATATCTTGCATTAGTATGG 0: 1
1: 4
2: 39
3: 265
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989553525 Original CRISPR ATTAGTAATAGGGAAGTGGT GGG (reversed) Intronic
902574397 1:17368148-17368170 ACTAGCAATGGGGGAGTGGTTGG + Intergenic
902762515 1:18591992-18592014 ATTAGTAATAGGAATTAGGTTGG + Intergenic
903422148 1:23225706-23225728 ATTAATAATAAGGCAATGGTGGG + Intergenic
903934706 1:26887452-26887474 ATGAGCAATAGGGAGGTTGTTGG - Intronic
904342806 1:29848527-29848549 ACTAGTAATGGGGAAGTGGCTGG + Intergenic
905528327 1:38656227-38656249 ATTAGTGTCAGGGATGTGGTAGG - Intergenic
906246319 1:44277062-44277084 ATCACTAATAGGGAAGGGCTGGG - Intronic
907641505 1:56195219-56195241 CTTAGAAATAGGGAAATGTTTGG + Intergenic
907962116 1:59293796-59293818 ATTAGTGATACAGAAGTGCTGGG + Intergenic
908667038 1:66505081-66505103 ATAATTAATTGTGAAGTGGTGGG + Intergenic
909686973 1:78360473-78360495 ATTTGTATTAGGTAAGTAGTAGG + Intronic
910766347 1:90786484-90786506 ATTAGTTATGGTGAAGTGGGTGG + Intergenic
911312431 1:96310203-96310225 ATTTATAATTGGGAAGTGGCTGG + Intergenic
912031999 1:105259685-105259707 ATTAGTAATAGTTAAGTTTTGGG - Intergenic
913019357 1:114771782-114771804 ATAAGTACTAATGAAGTGGTTGG + Exonic
915072775 1:153285807-153285829 AATAGTAATAGTAAAATGGTGGG - Intergenic
915144266 1:153785657-153785679 ACTAGTAAAGGGGAAGTGGCCGG - Intergenic
918085541 1:181241766-181241788 AGTAGTATTAGCGAAGTTGTGGG + Intergenic
919542542 1:198868500-198868522 TTTAGTAAAAGGTAAGTGGAAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922980485 1:229822106-229822128 ATTGGTAGTATGGATGTGGTTGG + Intergenic
923432596 1:233937636-233937658 ATTTGAAAAAGGGAAGTGATGGG + Intronic
1063229456 10:4049907-4049929 ATTAGTAGGAATGAAGTGGTAGG - Intergenic
1067950664 10:50734723-50734745 ATTAAGAACAGGGAAGTGGCTGG - Intergenic
1068449441 10:57166511-57166533 ATTAGTACCAGAGAAGTGGGGGG - Intergenic
1069345095 10:67459349-67459371 ATTAGTAGTGGGGATGGGGTAGG + Intronic
1070886007 10:79899920-79899942 ATTAAGAACAGGGAAGTGGCTGG - Intergenic
1078627362 11:12969737-12969759 CTTAGCACTAGGGAAGTGGGTGG - Intergenic
1079454988 11:20628611-20628633 GGTAGTGATAGGGGAGTGGTAGG + Intronic
1082832769 11:57631525-57631547 ATCAGTAATAAGGAAGTCATTGG + Intergenic
1084662812 11:70557094-70557116 ACTTGAAATATGGAAGTGGTTGG - Intronic
1085391807 11:76185962-76185984 ATTTGTAAAATGGGAGTGGTGGG - Intergenic
1085663399 11:78390955-78390977 AGCAGAAATAGGGAAGTGGGCGG + Intronic
1085791117 11:79498892-79498914 ATGAGTAATTGTGAGGTGGTGGG - Intergenic
1086739033 11:90343863-90343885 AGTAGTAGGAGGGAAGTGGTGGG + Intergenic
1088175545 11:107049193-107049215 ATTAGTACCTGGCAAGTGGTAGG + Intergenic
1089949325 11:122510425-122510447 ACTAGTGATATGGAAGTGCTGGG - Intergenic
1090678222 11:129025595-129025617 TTTAGTACTAAGGAAGAGGTTGG - Intronic
1094069935 12:26402035-26402057 AGGAGAAATAGGGAAGAGGTAGG + Intronic
1095560771 12:43562658-43562680 AGTAGTAGTAGGAAAGTAGTAGG + Intergenic
1096319858 12:50602131-50602153 ATTCGTAAGAGGGAAGAGGTGGG - Intronic
1097923117 12:65098510-65098532 AATAGCAAAACGGAAGTGGTTGG - Intronic
1099596125 12:84668607-84668629 ATTGGTAATTATGAAGTGGTCGG - Intergenic
1102500913 12:113351884-113351906 ATAAGTAAAAGGAAAGTGATTGG - Intronic
1104415808 12:128596009-128596031 ATCAGGAATGGGGAAGTGGGCGG - Intronic
1105957604 13:25299346-25299368 ATTAGTAATAGCAAAATGGCTGG - Intergenic
1109543563 13:63812040-63812062 AATTATAATAGAGAAGTGGTTGG - Intergenic
1109845310 13:67981450-67981472 ATTAGTACAAGGGACTTGGTAGG + Intergenic
1110192402 13:72745514-72745536 ATTAGTCATAGGGATGTTTTAGG + Intronic
1110926346 13:81158378-81158400 ATGACTAATAGGCAAGTGTTTGG - Intergenic
1112535838 13:100254532-100254554 ATAAGTAAATGGGAAGTGGAAGG - Intronic
1118284999 14:64463461-64463483 ATTAGTAAAAGGGAACTGAAAGG - Intronic
1121363901 14:93289219-93289241 ATCAGGAATAGGGAATTAGTAGG + Intronic
1126158635 15:45587811-45587833 ATTTGTCATACGGCAGTGGTGGG + Intronic
1127141674 15:55984268-55984290 ATTAGTAGCAGGAAAGTGGAAGG + Intronic
1127406317 15:58651395-58651417 ATGAGTATTAGAGCAGTGGTGGG - Intronic
1128438198 15:67676809-67676831 AAAAGTCATAGGAAAGTGGTTGG + Intronic
1129039906 15:72676800-72676822 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1129430561 15:75498379-75498401 GTTAGGAATGGGGAGGTGGTGGG + Intronic
1132177018 15:99724100-99724122 TTTAGTAATATGGCAGTGGATGG - Intronic
1138094385 16:54200645-54200667 ATTGGTAAAAGGAAAGGGGTTGG + Intergenic
1139760719 16:69182709-69182731 ATTAGCAGAAGGGAAGTGCTGGG - Intronic
1145872533 17:28286943-28286965 AATAGGAATAGGTAGGTGGTAGG - Intergenic
1148392545 17:47283263-47283285 CTTAGCTATTGGGAAGTGGTAGG + Intronic
1148402455 17:47378160-47378182 ATTAATAGTAGGGTAGTGCTGGG + Intronic
1150559304 17:66281117-66281139 TTTAGTAATAGGGACGGGGCTGG - Intergenic
1156549466 18:38000238-38000260 ATTACTAATAGGCTAATGGTTGG + Intergenic
1156993357 18:43437258-43437280 ATGAGTATTAGAGCAGTGGTGGG - Intergenic
1158371354 18:56809010-56809032 AACAGTAAAAGGGAAGTGGGAGG - Intronic
1159712247 18:71775276-71775298 ATTATCAATAGGGATGTGTTTGG - Intronic
1160632000 18:80253436-80253458 GATAGGAAAAGGGAAGTGGTGGG - Intergenic
1161641597 19:5427049-5427071 ATAAGAAATAGGGAAGAAGTTGG + Intergenic
1163951674 19:20593709-20593731 ATTAGCAAAAAGGTAGTGGTTGG + Intronic
1164244272 19:23416738-23416760 ATTAGGAATGGGGCAGGGGTGGG + Intergenic
1166452833 19:42916439-42916461 ATTATTACTTGGGCAGTGGTGGG + Exonic
925421502 2:3716465-3716487 TTTAGTAATATGGAGGTCGTGGG + Intronic
926026068 2:9545708-9545730 ATTAGTAACTGTGAAATGGTTGG + Intronic
929023642 2:37578261-37578283 ATTATTAATAAGTAAGTGTTAGG + Intergenic
930004411 2:46884816-46884838 AGTAATAATTGGGAAATGGTGGG + Intergenic
931417675 2:62097069-62097091 ATCAGTAACAGAGAAGTGGCTGG + Intronic
932083135 2:68733292-68733314 TTTAGTGACAGGGAAGTCGTAGG + Intronic
937100337 2:119263745-119263767 AGTAGCAAAAGGGAAGTTGTGGG - Exonic
938223240 2:129590519-129590541 ACTAGCAGTAGGGAAGTGGCTGG - Intergenic
940889494 2:159021433-159021455 ATTAAAAATAGGGAAGTAGCTGG + Intronic
940945854 2:159616323-159616345 AATAGAAATAAGGAGGTGGTGGG - Exonic
945846691 2:214953743-214953765 ATTGGTAATATGGAAATGTTTGG - Intronic
946028469 2:216687036-216687058 ATTCGAACTAGGGAGGTGGTAGG - Intronic
946183438 2:217962858-217962880 ATCAGAAAAAGGGCAGTGGTGGG + Intronic
947906502 2:233767276-233767298 ATTAATAGTTGGGAAGTGGCAGG - Intronic
1168984475 20:2036390-2036412 ATGAGTAGTAGGTAAGTGGGTGG + Intergenic
1169638649 20:7723290-7723312 ATTATTAATGGCAAAGTGGTAGG + Intergenic
1172756826 20:37291256-37291278 ATTAGTAATAGGGGAAACGTGGG - Intronic
1173426660 20:42949034-42949056 ATTTGTAATAGGGTTGTAGTTGG - Intronic
1174287139 20:49481789-49481811 ATTAGTAATGGGGAGGGGCTAGG - Intronic
1177084405 21:16684590-16684612 GTTTGTGATAGGGAGGTGGTGGG + Intergenic
1177587081 21:23110932-23110954 ATTAGTAATTAGAAAGTGGAGGG + Intergenic
1177730188 21:25019126-25019148 ATTTGTAATGAGGAAGTGATTGG - Intergenic
1179005584 21:37511275-37511297 ATTTTAAATAGGGAAGTGATTGG + Intronic
1183234392 22:36606375-36606397 ATTAGAGATATGGAAGTGGAGGG + Intronic
1184167262 22:42737201-42737223 ACTAGTAATGGGGAAGTAGCCGG - Intergenic
949219161 3:1608908-1608930 ATAAGAAAGAGGGAAGTGGGAGG + Intergenic
950682894 3:14597277-14597299 ATGAGAAATAGGGAACTGGGTGG + Intergenic
950692600 3:14672024-14672046 ATTAGTAATAAGGAGAGGGTTGG + Exonic
957669140 3:83278157-83278179 GTTAATATTTGGGAAGTGGTAGG - Intergenic
958471494 3:94526314-94526336 ATTGATAATGTGGAAGTGGTTGG - Intergenic
959269819 3:104192795-104192817 ATTAGTGATATGGGAGTGCTGGG - Intergenic
959649542 3:108738219-108738241 ATTAGAAATAGGGATGTTATCGG - Intergenic
964643746 3:158936384-158936406 CTTAGTAATAGGGAAGACTTTGG + Intergenic
967229113 3:187320844-187320866 ATTAGTAATGGGGAGCTGGGAGG + Intergenic
970086705 4:12355859-12355881 ATTTGTAATAAGAATGTGGTGGG - Intergenic
970254888 4:14157040-14157062 GTTAGTAATAGGGACATGATGGG - Intergenic
970820652 4:20208062-20208084 ATTGGTGATATGGAAGTGGATGG - Intergenic
971246398 4:24932778-24932800 ATTAGTCAGAGGGAAGTGTCAGG + Intronic
971746001 4:30581897-30581919 ATCAGTAAGAGGGAAGAGGCAGG + Intergenic
974208349 4:58736794-58736816 ATTTTTAATACGGAAGTGGAAGG + Intergenic
976603989 4:86965459-86965481 ATTAGCAAAAGGGAAGTGAAGGG + Intronic
981680057 4:147387287-147387309 AACAGAAATAGGGAAGAGGTTGG - Intergenic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
987234831 5:15932190-15932212 ATCAGTAAAAGTGAGGTGGTTGG + Intronic
987640731 5:20608652-20608674 AAAAGTAAGAGGGAAGTTGTTGG - Intergenic
989553525 5:42764037-42764059 ATTAGTAATAGGGAAGTGGTGGG - Intronic
989637756 5:43555319-43555341 ATTAATTATAGAGAAGTGGGAGG - Intronic
990190523 5:53254928-53254950 ATTATTGATGGGGAAGTGCTAGG - Intergenic
991265908 5:64717087-64717109 ATTAGTAATGGTGAAGTAGCAGG + Intronic
992141406 5:73800827-73800849 ATTGGGAAAAGGGAACTGGTAGG + Intronic
994600288 5:101894111-101894133 ACTAGTAAAAGAGAAGTGGCTGG + Intergenic
994998618 5:107098635-107098657 AGTAGGAGTTGGGAAGTGGTGGG - Intergenic
995167972 5:109069273-109069295 ATTTGTAATAGGCAAGAGTTTGG + Intronic
996272683 5:121626593-121626615 ATTAGTAATAAGAAAGTAATTGG - Intergenic
996440844 5:123488623-123488645 AATGGTTATAGGGAAGGGGTGGG + Intergenic
996714264 5:126574076-126574098 TTTAGGAATTGGAAAGTGGTGGG - Intronic
996979724 5:129476044-129476066 ATTATTACTAGAGAATTGGTAGG + Intronic
997337511 5:133118640-133118662 ATTAGTACCAGGGAAGTGAAAGG + Intergenic
997862281 5:137428761-137428783 ATTAGGAAGAGGGAGGTGTTAGG - Intronic
999353765 5:150904554-150904576 ATTAGTAACAGGGAAGTGAGAGG - Intronic
1001853724 5:174992575-174992597 ATTAGAAATTTGGAAGTGCTTGG + Intergenic
1003398893 6:5775526-5775548 ACTAGTAACAGGGATGTGGGGGG + Intergenic
1003401861 6:5797144-5797166 CTGAGTAATAGGCAAATGGTTGG - Intergenic
1006993036 6:38231928-38231950 ATGAGAAATAAGGAAGGGGTGGG + Intronic
1007676143 6:43596639-43596661 AATAGAAATAGGGAGTTGGTTGG + Intronic
1010128658 6:72465410-72465432 ATTAGCATTTGGAAAGTGGTTGG + Intergenic
1011104936 6:83768976-83768998 AATAGTAATGGGTACGTGGTGGG + Intergenic
1011320607 6:86088224-86088246 ACTAATGATAGGGCAGTGGTGGG + Intergenic
1012726095 6:102812293-102812315 ATTTAAAATAAGGAAGTGGTTGG + Intergenic
1018257658 6:161938510-161938532 ATTAGTTATATGGTGGTGGTAGG - Intronic
1018317749 6:162573913-162573935 ACTAGTCGTGGGGAAGTGGTTGG + Intronic
1018569376 6:165192634-165192656 ATTGGTAAAAGGGGAGAGGTTGG + Intergenic
1020607201 7:10354420-10354442 AATTGTAATGGGGGAGTGGTAGG - Intergenic
1022301272 7:29104768-29104790 ATAAGGAATAGGGAAGTGGGCGG + Intronic
1023119536 7:36895227-36895249 ATTGATAACAGGGAACTGGTGGG + Intronic
1024173827 7:46817920-46817942 ATTAGTAAGAGGGAAGAAGAAGG + Intergenic
1024330433 7:48149300-48149322 ATGAGTAGTAGGGAAGAGGAGGG - Intergenic
1026242116 7:68585180-68585202 ATTAGTAACAGGGAAGTCAGGGG - Intergenic
1031314965 7:120245141-120245163 ATTAGTTTTAGAGATGTGGTGGG - Intergenic
1031335898 7:120531332-120531354 AAGAGTAATAGGGAAGTGCATGG - Intronic
1031863885 7:127015604-127015626 AGATGTAATAGGGTAGTGGTCGG - Intronic
1033973738 7:147073785-147073807 ATTAGTAAAATTGAAGTTGTTGG + Intronic
1040792182 8:51244662-51244684 AATAGTGATAGGGAAATGGGAGG + Intergenic
1042082936 8:65075819-65075841 AATAGTTACAGAGAAGTGGTGGG + Intergenic
1043328296 8:79080784-79080806 AATAGTAACACGGGAGTGGTAGG + Intergenic
1044793249 8:95869915-95869937 AATAGTAAAAGGGATGTGGAGGG + Intergenic
1045260580 8:100569956-100569978 TTTAGTAATAGAGAAGTAGAAGG - Intergenic
1045701809 8:104875521-104875543 AATAGTGATAGGGATGGGGTTGG + Intronic
1046428815 8:114094483-114094505 ATTAGTCATGGTGAAGAGGTAGG + Intergenic
1057073017 9:92116391-92116413 ATTTGTAATAGGGGAAAGGTGGG - Intergenic
1058251996 9:102710651-102710673 ATTAATTATAAGGAAGTGGGAGG + Intergenic
1202628920 M:458-480 ATTAGTAGTATGGGAGTGGGAGG - Intergenic
1186972273 X:14860419-14860441 ATTAGTAATAAGAATGTGTTTGG + Intronic
1189048894 X:37622509-37622531 ATTAGTATAAGGGAAACGGTGGG - Intronic
1191899254 X:66023736-66023758 ACTAGGTATAAGGAAGTGGTGGG + Intronic
1192056830 X:67781706-67781728 ATTAGCTATAAGGAAGTGGGAGG + Intergenic
1192333110 X:70195397-70195419 ATTAGTAATAGCCAAGACGTGGG + Intronic
1193319869 X:80108587-80108609 ATTAATAATAGGAAAGTGGTAGG + Intergenic
1195535712 X:106007195-106007217 ATGAGTTATTGGGAAGTGGCAGG - Intergenic
1195651270 X:107287569-107287591 AGTAGTAATTGGGAAGTTGGGGG - Intergenic
1197272069 X:124435752-124435774 ATTACACACAGGGAAGTGGTGGG - Intronic
1197781343 X:130163708-130163730 ATTAGACATTGGAAAGTGGTTGG - Intronic
1198774300 X:140163290-140163312 ATTAGTATCATGAAAGTGGTAGG - Intergenic
1199358952 X:146894900-146894922 ATTAATATTGGTGAAGTGGTGGG + Intergenic