ID: 989559585

View in Genome Browser
Species Human (GRCh38)
Location 5:42836023-42836045
Sequence GGCCCCAGGAACCATGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989559581_989559585 -8 Left 989559581 5:42836008-42836030 CCAGCCCAGAGTTGAGGCCCCAG 0: 1
1: 0
2: 1
3: 31
4: 282
Right 989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989559585 Original CRISPR GGCCCCAGGAACCATGTTCC AGG Intronic
901054849 1:6444267-6444289 GGCAGCAGGACCCAGGTTCCTGG - Intronic
901635944 1:10670152-10670174 GGCCCCAGACACCATGGCCCAGG - Intronic
902703535 1:18189382-18189404 GGCACCAGGAACCAGTTTCGTGG + Intronic
903776846 1:25799313-25799335 GCCCCAAGGAACCAAGGTCCTGG + Intergenic
904148227 1:28413090-28413112 GGCACCAGGGACCAGGTTCATGG - Intronic
904909578 1:33923911-33923933 GGCACCAGGAACCAATTTCATGG - Intronic
908611353 1:65864991-65865013 TCCCCCAGGAGCCATGTCCCAGG + Intronic
909131296 1:71740537-71740559 GGCCCCAGGAAACATCTTTGTGG - Intronic
910266811 1:85346544-85346566 GGGCCCAGGAAACTTGTTTCTGG + Intronic
910343172 1:86210812-86210834 AGCACCAGGAACCAGTTTCCTGG + Intergenic
911201254 1:95046514-95046536 GGCACCAGGGACCAGGTTCATGG - Intronic
913239987 1:116821575-116821597 GGCACCAGGAACCAGTTTCGTGG - Intergenic
913550200 1:119910121-119910143 GGCACCAGGAACCAGTTTCGTGG + Intergenic
913579441 1:120211128-120211150 GGTACCAGGAACCATTTTCAAGG - Intergenic
913628731 1:120687260-120687282 GGTACCAGGAACCATTTTCAAGG + Intergenic
914322699 1:146580605-146580627 GGCCCCAGGTTCTATGCTCCAGG + Intergenic
914561376 1:148822555-148822577 GGTACCAGGAACCATTTTCAAGG - Intronic
914611459 1:149307653-149307675 GGTACCAGGAACCATTTTCAAGG + Intergenic
915508774 1:156374279-156374301 GGCACCAGGCACCAGTTTCCTGG - Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
919265096 1:195252390-195252412 GCCCCCAGGGACCAGTTTCCTGG - Intergenic
919983770 1:202658822-202658844 GGCCCCCTGAACCCTGCTCCTGG + Intronic
920919762 1:210288790-210288812 GGCACCAGGCACCATGTTAAAGG - Intergenic
920966077 1:210701766-210701788 GGCCCCAGAAACGATGTCTCTGG - Intronic
922137047 1:222839381-222839403 GGCACCAGGAACCAATTTCATGG - Intergenic
923289015 1:232526353-232526375 GGCACCAGGAACCGTTTTCGTGG + Intronic
924666681 1:246080504-246080526 GGCACCAGGAACCAGTTTCGTGG - Intronic
1063105151 10:2986125-2986147 GTCTGCAGGAATCATGTTCCAGG - Intergenic
1066589997 10:36984365-36984387 GGCACCAGGAACCAGGTTTGTGG + Intergenic
1069867141 10:71511016-71511038 GGGCCCTGGAGGCATGTTCCTGG + Intronic
1070948049 10:80409025-80409047 GGCCCCCGGGCCCATGCTCCAGG - Intronic
1072686928 10:97543031-97543053 GGCTCCAGGAACCATGTTTTTGG + Intronic
1072884264 10:99259989-99260011 GGCACCAGGAACCAGGTTAGTGG - Intergenic
1073232363 10:101982980-101983002 GGCACCAGGAACCAGTTTCATGG - Intronic
1074934645 10:118165895-118165917 GGCACCAGGGACCAGGTTCGTGG - Intergenic
1075063778 10:119275089-119275111 TGTGCCAGGAACCATGCTCCTGG - Intronic
1076061473 10:127417220-127417242 GGCCACGGGGACCATGTCCCAGG - Intronic
1077112191 11:866763-866785 AGCCCCCGGAACCCTGTTTCTGG + Exonic
1077356273 11:2120377-2120399 GGCCACATGTCCCATGTTCCGGG - Intergenic
1077528610 11:3084043-3084065 GGACCCAAAAACCATGTTCAGGG + Intergenic
1080920296 11:36702013-36702035 GGCCCCAGCAAACATGTTGCTGG - Intergenic
1084171707 11:67404190-67404212 GGCCCCGGGCACCATGGCCCAGG + Exonic
1084378886 11:68798122-68798144 GGCCTCAGGACACATGTGCCAGG - Intronic
1084672706 11:70616582-70616604 GGCACCAGGGACCTGGTTCCAGG - Intronic
1084785908 11:71441570-71441592 GGCCCCAGGAACCATCTCTGAGG + Intronic
1084984856 11:72859934-72859956 GGCACCAGGAACCAGTTTCATGG + Intronic
1085009691 11:73129765-73129787 GGCACCAGGGACCAGTTTCCTGG - Intronic
1085053379 11:73390963-73390985 GGCCCCAGGATCCAGAGTCCTGG - Intronic
1085385090 11:76153048-76153070 GGCCCCAGGGACCAGGCTTCAGG + Intergenic
1085450270 11:76627745-76627767 GGTCCAGGAAACCATGTTCCTGG + Intergenic
1085808841 11:79661885-79661907 GGCCCCAGGAGCAATTTTCTGGG + Intergenic
1085827195 11:79860148-79860170 GACTCCAGCTACCATGTTCCAGG + Intergenic
1085898083 11:80663681-80663703 GGCGCCAGGAACCAGGTTCGTGG - Intergenic
1087159238 11:94933027-94933049 GGCTCCAGCTACCAGGTTCCAGG + Intergenic
1087524837 11:99296672-99296694 GGCACCAGAAACCACTTTCCTGG - Intronic
1087886511 11:103489040-103489062 GGCACCAGGAACCAGTTTCGTGG - Intergenic
1090393944 11:126406881-126406903 GACCCAGGGACCCATGTTCCAGG - Intronic
1090406779 11:126480738-126480760 GGCCCCAGGAAGCATGAGCCTGG + Intronic
1091599925 12:1912038-1912060 GGCCCCAGCAACCCTGACCCCGG + Intronic
1091942276 12:4498685-4498707 GGCACCAGGAACCAGTTTCACGG + Intronic
1092781079 12:11988074-11988096 GGCACCAGGAACCAGTTTCTTGG + Intergenic
1096184933 12:49572685-49572707 GGCCCCAGGCTCCATCTTCTGGG + Intronic
1096718598 12:53505393-53505415 GGCCCCAGGAACCCTGGGTCTGG - Intronic
1097897230 12:64837222-64837244 GGCACCAGGGACCAGTTTCCGGG + Intronic
1097973881 12:65664323-65664345 GGCACCAGGAACCAGTTTCATGG + Intergenic
1098370084 12:69749388-69749410 GGCCCCAGGGACCAGTTTCGTGG - Intronic
1101804177 12:108048955-108048977 GTCCCCAGCAAGTATGTTCCTGG - Intergenic
1102149696 12:110680252-110680274 GGCTCCAGGCTCCAGGTTCCAGG + Intronic
1102614718 12:114143506-114143528 GTCACCATGAACCATGTTTCAGG + Intergenic
1104018765 12:124977628-124977650 GGGACCAGGAGCCATGGTCCAGG + Intronic
1105703957 13:22957442-22957464 GGACCCAGGAACTGTGTGCCTGG + Intergenic
1105856909 13:24382526-24382548 GGACCCAGGAACTGTGTGCCTGG + Intergenic
1108522747 13:51260064-51260086 GGCCCCAGGAGCCCTCCTCCCGG - Intronic
1109509492 13:63351376-63351398 GGCCCCAGGGGCAATGCTCCAGG - Intergenic
1110010363 13:70325547-70325569 GGCACCAGGAACAGTTTTCCTGG + Intergenic
1113013100 13:105793416-105793438 GGCCTCAGGAAACATATTCATGG + Intergenic
1113465095 13:110507223-110507245 GCCCCCGGGAAGCATGTTGCTGG + Intronic
1115457280 14:33618162-33618184 GGCACCAGGAACCAGTTTCATGG + Intronic
1116031893 14:39583607-39583629 GGCACCAGGAACCATTTTCGTGG - Intergenic
1121149218 14:91615394-91615416 GGCACCAGGAACCAGTTTCATGG - Intronic
1121181202 14:91930384-91930406 GGCCCCAGCAAGCTTGTTCATGG - Intronic
1121945155 14:98113296-98113318 TGCCTGAGGCACCATGTTCCTGG + Intergenic
1123011399 14:105351146-105351168 GGTCCCAGGCACAAGGTTCCCGG - Intronic
1123685222 15:22792298-22792320 GTCCCCAGGAAGCCTGTCCCAGG - Intronic
1123996463 15:25721210-25721232 GTTCCCAGGAACACTGTTCCAGG + Intronic
1124662580 15:31562384-31562406 GGCACCAGGTACCAGGTACCAGG - Intronic
1126821699 15:52510769-52510791 GGCCCCAGGGACCAGTTTCATGG - Intronic
1127827480 15:62717805-62717827 TGCCCCAGTTCCCATGTTCCAGG + Intronic
1128383223 15:67128474-67128496 TACACCAGGAACTATGTTCCTGG - Intronic
1128682131 15:69659926-69659948 GGCCCCAGGCATCACATTCCTGG - Intergenic
1130747124 15:86666893-86666915 GGCCCCAAGACCCATATTGCTGG - Intronic
1131002278 15:88948597-88948619 GGAACCAGGAACAAGGTTCCAGG - Intergenic
1132014541 15:98303986-98304008 GTCACCAGGAAGCATCTTCCTGG - Intergenic
1132033303 15:98457084-98457106 GGCACCAGGAACCAGTTTCATGG + Intronic
1132067401 15:98743625-98743647 GGCCCCAGAAGCCATGTTGAGGG + Intronic
1132704556 16:1237480-1237502 GCCCTCAGGAACCATGCGCCTGG + Intergenic
1132706957 16:1248945-1248967 GCCCTCAGGAACCATGCGCCTGG - Intergenic
1135042217 16:19126401-19126423 GGCACCAGGAACCAGTTTCATGG - Intronic
1135622570 16:23968466-23968488 GCCAGCAGGAACCATGGTCCTGG + Intronic
1138205200 16:55119663-55119685 GGGCCCAGGCACATTGTTCCTGG + Intergenic
1138205202 16:55119667-55119689 GGGGCCAGGAACAATGTGCCTGG - Intergenic
1140010865 16:71130243-71130265 GGCCCCAGGTTCTATGCTCCAGG - Intronic
1140312324 16:73861616-73861638 GGCCATTGGCACCATGTTCCAGG + Intergenic
1140312778 16:73865601-73865623 GGCCATTGGCACCATGTTCCAGG + Intergenic
1140661551 16:77194573-77194595 GGACCCAGGAGCCCTGCTCCTGG + Exonic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1144584540 17:16480306-16480328 GGCACCAGGGACCAGTTTCCTGG - Intronic
1145081211 17:19895851-19895873 GTCCCCAGGAAGCATGACCCAGG - Intergenic
1147179141 17:38673953-38673975 CGCCTCAGGAACCCAGTTCCCGG - Exonic
1147685557 17:42284804-42284826 GGCACCAGGATCCAAGTTGCCGG - Intergenic
1148033329 17:44638343-44638365 GGCACCAGGGACCAGTTTCCTGG + Intergenic
1149817742 17:59742966-59742988 GGCACCAGGAACCAGTTTCGTGG - Intronic
1151006525 17:70443782-70443804 GGCACCAGGGACCAGTTTCCTGG - Intergenic
1152516461 17:80827609-80827631 GGCCCCAGGACCCCTGTCCCAGG - Intronic
1155528178 18:26738745-26738767 GGCACCAGGAACCAGTTTCGTGG - Intergenic
1158810108 18:61022023-61022045 GGCACCAGGGACCATTTTCGTGG - Intergenic
1160859620 19:1232149-1232171 GGCCCCAGCAAACAGGTTCTGGG + Intronic
1161087117 19:2340403-2340425 GTCCCCAGGAACCCTGCCCCAGG + Intronic
1161446998 19:4324030-4324052 GACCCCAGGACCCATGTGTCTGG - Exonic
1161850410 19:6735255-6735277 GGCCCCAGAATCCCAGTTCCTGG + Intronic
1162531616 19:11239447-11239469 AGCCCCAGGAAGCGTGATCCCGG + Intronic
1163664014 19:18594675-18594697 GGCCACAGGAATCGGGTTCCTGG - Intronic
1164541865 19:29127508-29127530 GCCCCCAGGAGGGATGTTCCAGG - Intergenic
1164593269 19:29517743-29517765 GGCCCCAGGACCCATTCTCAGGG + Intergenic
1165140442 19:33696686-33696708 GGCACCAGGAACCAGTTTCGTGG - Intronic
1166083011 19:40456820-40456842 GGTCCCAGGCACCATGAACCCGG + Intronic
1167097065 19:47380173-47380195 GGCCTCTGGAACCAGGCTCCTGG - Intronic
1168258278 19:55179032-55179054 GGACCCCGCCACCATGTTCCCGG - Exonic
1168401046 19:56086587-56086609 GTCCTGAGGACCCATGTTCCTGG - Intergenic
1168551798 19:57302419-57302441 TGGCCCAGGCACCATTTTCCTGG + Intergenic
925174450 2:1772286-1772308 AGCCCAAGGATCCACGTTCCAGG + Intergenic
927141868 2:20136332-20136354 GGCCCAAGGCACCATGTCCATGG - Intergenic
927425356 2:22975346-22975368 GGCCTCTGGAAACATTTTCCAGG + Intergenic
931489039 2:62724943-62724965 GGCACCAGGAACCAATTTCATGG - Intronic
934614702 2:95763935-95763957 GGAGCCAGGAGCCCTGTTCCGGG + Intergenic
934646202 2:96060560-96060582 GGAGCCAGGAGCCCTGTTCCGGG - Intergenic
934839605 2:97616643-97616665 GGAGCCAGGAGCCCTGTTCCGGG - Intergenic
935018973 2:99212242-99212264 GGCACCAGGAACCAGTTTCATGG + Intronic
935259580 2:101343160-101343182 CACCCCAGCCACCATGTTCCCGG + Intergenic
935276112 2:101476545-101476567 GGCCCCAGCAACTACCTTCCAGG - Intergenic
936048161 2:109202629-109202651 GGCCCCAGGAACCTGGGTCCTGG + Intronic
937869477 2:126777103-126777125 GGCCCCAGGGTCCACATTCCTGG - Intergenic
937940627 2:127282891-127282913 AGCCCCAGGTCCCAGGTTCCAGG - Intronic
939395758 2:141627697-141627719 GGCACCAGGAACCAGTTTCGTGG - Intronic
939712234 2:145536670-145536692 GACCACAGGAACCATCCTCCTGG + Intergenic
940560166 2:155284867-155284889 GGCCCCAGGCTCCAGGCTCCAGG - Intergenic
944590904 2:201217204-201217226 GACACCAGGTACCATGTACCAGG - Intronic
945318975 2:208399647-208399669 GACCCCTGGAAGCTTGTTCCTGG + Intronic
946555608 2:220853603-220853625 TCACCCAGGAACCATCTTCCTGG + Intergenic
946574962 2:221064742-221064764 TGCTCCAGGTGCCATGTTCCTGG - Intergenic
946584565 2:221170283-221170305 GGCACCAGGAACCAGTTTCGTGG - Intergenic
948087324 2:235262588-235262610 GGTCCCCTAAACCATGTTCCAGG + Intergenic
948165396 2:235857367-235857389 GGCACCAGGGACCAGTTTCCTGG - Intronic
948395516 2:237642444-237642466 GGCTCCAGGCTCCAGGTTCCAGG + Intronic
1169092252 20:2868133-2868155 GGACCCAGCCACCATGTTGCAGG - Intronic
1170844968 20:19954592-19954614 GACCACAGGCACCATGATCCCGG - Intronic
1171723201 20:28587238-28587260 GGACCCCAGCACCATGTTCCAGG - Intergenic
1173257695 20:41406580-41406602 CGCTCCAGGGACCAGGTTCCTGG - Intronic
1173937351 20:46878639-46878661 GGCCAAAGGAAACTTGTTCCTGG - Intergenic
1175870775 20:62208433-62208455 GGCCCCAGGGTCCAGGTCCCAGG + Intergenic
1175930195 20:62490210-62490232 GGCCCCAGGGCCCATGTTCTTGG - Intergenic
1175961147 20:62637017-62637039 GGCCCTGGGCAACATGTTCCAGG + Intergenic
1176428617 21:6563244-6563266 GAGCTCAGGAAGCATGTTCCAGG - Intergenic
1178604972 21:34028239-34028261 GGCACCAGGGACCAGTTTCCTGG - Intergenic
1179704107 21:43171560-43171582 GAGCTCAGGAAGCATGTTCCAGG - Intronic
1182127995 22:27830130-27830152 GTCCCCAGGAACCTTGATCATGG + Intergenic
1183209010 22:36438719-36438741 GGCTTCAGGAACCAGGTGCCTGG - Intergenic
1183245753 22:36692218-36692240 GGCTCCAGCAACCATGCACCTGG + Intronic
1184140017 22:42573122-42573144 GGCCCCAGGGTCAGTGTTCCCGG - Intronic
1184296295 22:43527526-43527548 GACCCCAGGAAACATTTTCCAGG + Intergenic
1184651144 22:45920013-45920035 GCCCCCAGTAACCAGGTGCCAGG + Intergenic
949877417 3:8635320-8635342 GGCCCCAGGAGCAAAGGTCCTGG - Exonic
950940051 3:16883943-16883965 AGCCCCGGGACCCTTGTTCCGGG + Intronic
951530206 3:23691896-23691918 GGCCCCAGGCATCTTGCTCCTGG - Intergenic
951844810 3:27073730-27073752 GGCTGCAGGATGCATGTTCCTGG - Intergenic
953940126 3:47087294-47087316 GGCACCAGGAACCAGTTTCAGGG + Intronic
954137705 3:48589633-48589655 GGCGCCAGGAACCCTGGTCCAGG + Exonic
954138187 3:48591932-48591954 GGCCTCAGGCACCAAGTTCCAGG + Exonic
954463491 3:50640901-50640923 GGCCCCAAGCACCCAGTTCCTGG - Intronic
955747636 3:62155873-62155895 GTCACCTGGAACCCTGTTCCCGG + Intronic
956969194 3:74502515-74502537 GGCACCATGAACTATGTGCCAGG + Intronic
958713136 3:97742352-97742374 GGCCGTAGGAACCATGTGCTGGG + Intronic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
961865245 3:129949096-129949118 GGCCCCAAGAAACCTGTTACAGG - Intergenic
966163391 3:176991050-176991072 GCCACCAGGGACCAGGTTCCTGG + Intergenic
966687505 3:182711929-182711951 GGCACCAGGAACCAGTTTCGTGG - Intergenic
966911456 3:184562377-184562399 GACCCCAGGCACCTTGTTCCCGG - Intronic
968445285 4:649414-649436 AGCCCCAGGAGCCTTGTTTCTGG - Intronic
968520094 4:1031286-1031308 GGCCCCCAGACCCAGGTTCCTGG + Intergenic
968619505 4:1597451-1597473 GAGCCCAGGAACCATGCTGCTGG + Intergenic
970161783 4:13196754-13196776 GGCCCCTGGAACCATGTCATGGG - Intergenic
970235677 4:13955910-13955932 GGCACCAGGAACCAGTTTCGTGG - Intergenic
971143292 4:23948177-23948199 GGTCCCAGGAACCATGTGGTTGG + Intergenic
972340144 4:38145462-38145484 GGCCCTAGGGACCATGCTCTTGG + Intergenic
972675080 4:41252287-41252309 GGCCCCAGGGACCAGTTTCATGG + Intergenic
973715437 4:53671094-53671116 GACCCCAGGAAGCATGGCCCTGG - Intronic
975932180 4:79538365-79538387 GGCCCCAGGAATCATGATCGAGG + Intergenic
978123366 4:105108272-105108294 TGCCATAGGAACCATATTCCTGG - Intergenic
979351162 4:119646059-119646081 GGCACCAGGTACCAGGTTCACGG - Intergenic
980823826 4:138050578-138050600 GGCACCAGGAACCAGTCTCCTGG + Intergenic
983631808 4:169857032-169857054 GGCACCAGGAACCAGTTTCATGG + Intergenic
984911727 4:184679916-184679938 GGCACCAGGAACCGGTTTCCTGG - Intronic
986503895 5:8429823-8429845 GGCCCCGGGAGACAGGTTCCTGG - Intergenic
986783718 5:11090677-11090699 GGCACCAGGAACCAGTTTCGTGG - Intronic
987594673 5:19981788-19981810 TGTCTCAGGAACCATATTCCAGG - Intronic
987836409 5:23168695-23168717 GGCACCAGGAACCAGTTTCATGG - Intergenic
988452468 5:31357092-31357114 GGCACCAGGAACCAGTTTCATGG + Intergenic
988733980 5:34002498-34002520 GACCCCAGGGACCATGCTCTTGG + Intronic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
989561326 5:42855457-42855479 GGCACTAGGAGCCATGCTCCTGG + Intronic
990119017 5:52425821-52425843 GGCACCAGCAACCAAGTTCATGG - Intergenic
992171405 5:74105521-74105543 GGCCCAAGGAACCATGCTGTGGG - Intergenic
993157183 5:84240700-84240722 GGCACCAGGAACCAGTTTCGTGG - Intronic
995448716 5:112276811-112276833 GCACCCTGGAACCCTGTTCCTGG + Intronic
995548086 5:113252706-113252728 GGCACCAGGGACCAGTTTCCTGG - Intronic
997732649 5:136192443-136192465 GGCCCCAGGAGCCACGGTCAAGG - Intergenic
997737587 5:136225503-136225525 GGTCCTAGGAACAATGTTCTAGG - Intronic
1001350234 5:170955151-170955173 GGCACCAGGGACCAGTTTCCTGG - Intronic
1002136785 5:177112655-177112677 GGCAACAGGTACCATGGTCCTGG + Intergenic
1002142250 5:177149567-177149589 GGCACCAGGGACCAAATTCCTGG + Intronic
1002421104 5:179149508-179149530 GGCCGCAGGAACCAGGAGCCAGG + Intronic
1002877878 6:1227155-1227177 AACCCCAGGACCCTTGTTCCTGG - Intergenic
1003344897 6:5257802-5257824 GGCACCAGGAACCAATTTCATGG - Intronic
1003895334 6:10602254-10602276 AGCTCAAGAAACCATGTTCCTGG + Intronic
1004028893 6:11846801-11846823 GGTCCCTGGCACCATATTCCAGG + Intergenic
1006819468 6:36880290-36880312 GGCACCAGAAACCCTTTTCCTGG + Intronic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1013104325 6:107013821-107013843 GGCACCAGGGACCAGTTTCCTGG + Intergenic
1014604467 6:123454880-123454902 GGCACCAGGAACCTGGTTCCTGG - Intronic
1015646167 6:135391279-135391301 GGCACCAGGGACCAGGTTCATGG + Intronic
1015985614 6:138881440-138881462 GGCACCAGGAACCAGTTTCATGG + Intronic
1016326865 6:142912809-142912831 GGCACCAGGAACCAGTTTCATGG - Intronic
1016441156 6:144084796-144084818 GGCCCCAGGGACCAGTTTCATGG - Intergenic
1018717473 6:166544630-166544652 AGGCCCAGGACCCATGCTCCTGG + Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1021448733 7:20761063-20761085 GGCACCAGGGACCAGTTTCCTGG - Intronic
1022234612 7:28448767-28448789 GGCCCCAGGGCCCATGTTCCTGG - Intronic
1022388817 7:29926302-29926324 GGCCCCAGGAACCTGGTCTCTGG + Intronic
1023049750 7:36240755-36240777 GGCACCAGGGACCAGTTTCCTGG + Intronic
1023187674 7:37548828-37548850 GGCACCAGGGACCAGTTTCCTGG - Intergenic
1024281690 7:47724152-47724174 GGCACCTGGAACCAGTTTCCTGG - Intronic
1025079612 7:55970231-55970253 GTGCCCAGGAAGCATGTTCCTGG + Intronic
1026152275 7:67798271-67798293 GGCACCAGGAACCAGTTTCATGG + Intergenic
1027937815 7:84632163-84632185 GACCCCAGGCACCAAGTCCCTGG - Intergenic
1028098756 7:86794714-86794736 AGCCCCAGGAACCATGCTAGGGG - Intronic
1030865562 7:114698393-114698415 GGCCTCAGGAACCAGGATTCTGG - Intergenic
1031959513 7:127976130-127976152 GGCACCAGGAACCCTGGTCGGGG + Intronic
1032591548 7:133196641-133196663 GGCACCAGGGACCAGTTTCCTGG + Intergenic
1035371653 7:158382976-158382998 GGCACCAGGGACCAGCTTCCTGG - Intronic
1035587379 8:786305-786327 GTCACCAGGAGCCATGGTCCGGG + Intergenic
1036382669 8:8247715-8247737 GGCACCAGGAACCAGTTTCATGG - Intergenic
1036627279 8:10482785-10482807 GTCCCCAAGACCCAGGTTCCTGG + Intergenic
1036966315 8:13301939-13301961 GGCACCAGGAACCAGTTTCATGG - Intronic
1041079422 8:54202393-54202415 TGGCCCAGGAACCATTTCCCTGG + Intergenic
1046948570 8:119998586-119998608 GGCCCCAAAAGCCATGTTCCTGG - Intronic
1047782760 8:128123361-128123383 GGACCCAGGAACCATCTACCTGG + Intergenic
1047941671 8:129832483-129832505 GGCACCAGGGACCAGTTTCCTGG + Intergenic
1048574297 8:135678950-135678972 GGCCCCAAAACACATGTTCCAGG + Intergenic
1048583448 8:135750167-135750189 GGCACCAGGGACCAGTTTCCTGG - Intergenic
1049061153 8:140277207-140277229 GCCCCCAGGAAACACGTGCCCGG - Intronic
1049461156 8:142728445-142728467 GGCCCCAGGTGCCATGCTGCAGG - Intronic
1049641168 8:143716638-143716660 GCCTCCAGGAGCCAGGTTCCTGG - Intronic
1049718931 8:144106760-144106782 GGCCCCAGGGAGGATGTTCAGGG - Intronic
1051834498 9:21320112-21320134 GCCCCCATGAAGCTTGTTCCAGG - Intergenic
1058287175 9:103192583-103192605 GGCACCAGGAACCAATTTCGTGG - Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1059563870 9:115363192-115363214 GGCACCAGGGACCATGTTTGTGG + Intronic
1059668653 9:116473155-116473177 GGAGGCAGGAACCATGTTCTTGG + Intronic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1060874376 9:127070038-127070060 GGCACCAGGGACCAGTTTCCTGG + Intronic
1061630972 9:131872017-131872039 GGCCCCAGGGGGCATGCTCCTGG + Intronic
1061929003 9:133822670-133822692 GGCCCCAGCTACCAGATTCCCGG + Intronic
1062076025 9:134590418-134590440 GCCCTCAGGATCCATGTGCCTGG - Intergenic
1062489630 9:136798994-136799016 GGCCCCAGGCCCCAGGGTCCAGG - Intronic
1062604714 9:137341548-137341570 GGCACCAGGAGCCATCTCCCAGG + Intronic
1062677716 9:137757422-137757444 GGCCCAAGGTGCCATGTTGCAGG - Intronic
1185728132 X:2439451-2439473 GGCACCAGGAACCAGTTTCATGG + Intronic
1191041331 X:56083919-56083941 GGCACCAGGGACCAGTTTCCTGG - Intergenic
1191876859 X:65806645-65806667 GGCCCCAGGATCCCTGGTCAGGG + Intergenic
1192200253 X:69062044-69062066 GGACGGAGGAACCATGTTCTGGG + Intergenic
1192221506 X:69200458-69200480 GGCCCCAGCAGGAATGTTCCTGG + Intergenic
1192597143 X:72422884-72422906 TCCCCCTGGAACCATGGTCCAGG + Intronic
1193736180 X:85159546-85159568 GGCACCAGGGACCAGTTTCCCGG - Intergenic
1195412120 X:104578701-104578723 GGCTCCAGGAGGGATGTTCCAGG + Intronic
1195726151 X:107918682-107918704 GGCCCATGTAACTATGTTCCTGG + Intronic
1195968762 X:110452483-110452505 AGCCTCAGGAACGATGTTCACGG + Exonic
1198075041 X:133185922-133185944 GGCTCCAGGATCTCTGTTCCAGG - Intergenic
1199041576 X:143120547-143120569 GGCCTCAGGAAACATGATCATGG + Intergenic
1199200008 X:145076129-145076151 GGCACCAGGGACCATTTTCGTGG + Intergenic
1199449038 X:147958951-147958973 GGCCTCAGCCACCATTTTCCTGG + Intergenic
1200019511 X:153189902-153189924 GGCACCAGGAACCGGTTTCCTGG - Intergenic
1200064690 X:153498706-153498728 GGCCCCAGGGAAGGTGTTCCCGG - Intronic