ID: 989560258

View in Genome Browser
Species Human (GRCh38)
Location 5:42842251-42842273
Sequence TGCCAGCTAGAACCCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989560253_989560258 8 Left 989560253 5:42842220-42842242 CCTCCCTAGCCTACAGTTTTCTA 0: 1
1: 0
2: 0
3: 12
4: 187
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560252_989560258 13 Left 989560252 5:42842215-42842237 CCAAGCCTCCCTAGCCTACAGTT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560254_989560258 5 Left 989560254 5:42842223-42842245 CCCTAGCCTACAGTTTTCTAAAG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560251_989560258 14 Left 989560251 5:42842214-42842236 CCCAAGCCTCCCTAGCCTACAGT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560250_989560258 17 Left 989560250 5:42842211-42842233 CCTCCCAAGCCTCCCTAGCCTAC 0: 1
1: 0
2: 3
3: 32
4: 303
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560256_989560258 -1 Left 989560256 5:42842229-42842251 CCTACAGTTTTCTAAAGAAAACT 0: 1
1: 0
2: 3
3: 39
4: 434
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135
989560255_989560258 4 Left 989560255 5:42842224-42842246 CCTAGCCTACAGTTTTCTAAAGA 0: 1
1: 0
2: 2
3: 42
4: 341
Right 989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989560258 Original CRISPR TGCCAGCTAGAACCCTGTGG AGG Intronic
901633345 1:10658491-10658513 TGCCAGGTAGGCCCCTGGGGAGG - Exonic
905853368 1:41290674-41290696 TGTCAGCTGGAACCCTGGTGGGG + Intergenic
907428614 1:54397280-54397302 TGCCTGCCAGAACCCTTTCGGGG - Intronic
911039854 1:93582940-93582962 TGGCAGCTTGCAGCCTGTGGGGG + Exonic
911568870 1:99498211-99498233 TGGCAGGTAGCAACCTGTGGAGG - Intergenic
914446073 1:147751602-147751624 TGACTGCCAGAACCCTGGGGTGG + Intergenic
914913039 1:151802027-151802049 TGCCAGCTGGGGCCCTGCGGGGG - Exonic
916883326 1:169043832-169043854 TGCCACCTGGATCCCTGTAGTGG - Intergenic
919454088 1:197802039-197802061 TGCCAGCCAGAAACCTCTGTGGG - Intergenic
919934265 1:202241341-202241363 TACCAGCTAGAACCAGATGGGGG + Intronic
920340761 1:205273863-205273885 TCCCAGCAGTAACCCTGTGGGGG + Intergenic
921729632 1:218562827-218562849 TGCCATCTTGAACCATGAGGAGG + Intergenic
1066071207 10:31815351-31815373 TGCCAGATAGAGCACTGTAGAGG - Intronic
1067397881 10:45940468-45940490 TGCCAACTTGGAGCCTGTGGAGG + Intergenic
1067866200 10:49909559-49909581 TGCCAACTTGGAGCCTGTGGAGG + Intronic
1069356912 10:67597555-67597577 TGCATGCTCTAACCCTGTGGGGG + Intronic
1070161737 10:73870966-73870988 TGCCAGCCAGTACTGTGTGGAGG - Intronic
1070697122 10:78571774-78571796 AGCCAGAGAAAACCCTGTGGTGG + Intergenic
1075615649 10:123889442-123889464 TCCCAGCTAGTTCCATGTGGTGG + Intronic
1077952111 11:6970909-6970931 TGCCCCATACAACCCTGTGGGGG + Intronic
1078000456 11:7490529-7490551 TTCCAGCTAGAGCTCAGTGGAGG + Intronic
1078158166 11:8816605-8816627 TGGCAGCTAGAACCCAGTGTAGG - Intronic
1079248856 11:18772892-18772914 TGCCAGCCAGACCCCTAAGGAGG + Intronic
1080190207 11:29536187-29536209 TGCCAGGTTGATCCCTGTGTAGG - Intergenic
1084171797 11:67404492-67404514 TGCCAGGTGGAACCCTAAGGTGG + Intronic
1084548823 11:69828685-69828707 TGACAGCAAGCACCATGTGGGGG - Intergenic
1089204489 11:116748517-116748539 TGCCAGCAAGAAGGCAGTGGAGG - Exonic
1089524364 11:119087133-119087155 TTCCAGCTTGAACCCAGGGGTGG + Intronic
1090374374 11:126278589-126278611 TGCCATCTTGGAGCCTGTGGAGG - Intergenic
1091058989 11:132444284-132444306 TGCCCTCTAGAAACCTGTGAGGG + Intronic
1092002226 12:5042575-5042597 TGCCTGCTAAAACCCTGCAGGGG + Intergenic
1093275631 12:17121700-17121722 TTCCAGCTGGAACCCCATGGAGG + Intergenic
1096217116 12:49803869-49803891 TGCCAGCCAGAGCCCTGGGGAGG - Intronic
1096225351 12:49863119-49863141 TGCCATCTTGAATCCTGTGGAGG + Intergenic
1098580603 12:72094618-72094640 TCCCAGCTAGGACCCTGAAGTGG - Intronic
1105597081 13:21849007-21849029 TGCCAGCTATAGCACTGCGGGGG - Intergenic
1108018004 13:46096268-46096290 TGCAAGCTTAACCCCTGTGGAGG - Intronic
1109008070 13:56903562-56903584 TGCCAAGTATAACCCTATGGTGG - Intergenic
1112134372 13:96560061-96560083 TGCCAACTATAGGCCTGTGGAGG - Intronic
1112338488 13:98534021-98534043 TGCCCGCTAGCACCAGGTGGTGG - Intronic
1120039634 14:79738056-79738078 TCCCAGCTAGATCCCCCTGGTGG - Intronic
1120416808 14:84229701-84229723 AGCCATCTGCAACCCTGTGGAGG - Intergenic
1122209740 14:100166423-100166445 TGCCCACTAGGTCCCTGTGGGGG - Intergenic
1122791156 14:104184765-104184787 ACCCAGTGAGAACCCTGTGGAGG - Intergenic
1128359742 15:66953676-66953698 TGCCAGGCAGAGCCCTGTGCGGG - Intergenic
1129186739 15:73911869-73911891 TCCCAGCTAGATCCCTGAGCTGG + Intergenic
1132526201 16:416378-416400 TGCCAGCCAGAAACCCGTGATGG - Intergenic
1134327525 16:13220726-13220748 TTCCATCCAGAACCCTGTGTGGG + Intronic
1135421770 16:22309609-22309631 TGAAAGCTAGACACCTGTGGGGG + Intronic
1137799149 16:51246749-51246771 CGCCATCTAGCAACCTGTGGTGG - Intergenic
1138599850 16:58047829-58047851 TGCCACCAAGGCCCCTGTGGTGG - Intergenic
1138689414 16:58753642-58753664 TGCCAGCCAGAGACCTCTGGTGG + Intergenic
1139434084 16:66926202-66926224 TGCCTGCTTGAACCCTGGGGAGG + Intergenic
1139664110 16:68444266-68444288 AGCCAGCTGGATCACTGTGGAGG - Intronic
1140429405 16:74888767-74888789 TGCCTGCTAGCATGCTGTGGCGG - Intronic
1140555622 16:75917693-75917715 TGCCAGCAAGAGTGCTGTGGGGG - Intergenic
1141593217 16:85082200-85082222 AGGCAGCTAAAACCCTCTGGGGG + Intronic
1141696914 16:85624513-85624535 TGGCAGCTCTCACCCTGTGGCGG - Intronic
1146650538 17:34603549-34603571 TGCCTGCTGGATCCCTGTGCAGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1152123638 17:78433658-78433680 TCCCAGCTCACACCCTGTGGTGG + Intronic
1152179018 17:78806269-78806291 TGCAGGCCAGCACCCTGTGGAGG - Exonic
1155890556 18:31263005-31263027 AACCAACTAGAACCATGTGGAGG + Intergenic
1158829692 18:61263812-61263834 TCCCAGCCAGAACTCTGAGGAGG + Intergenic
1160414437 18:78698294-78698316 TGCCAGTCAGGACCCTGTGGTGG - Intergenic
1160893183 19:1390252-1390274 TGCCCGCCAGAAGCCTGTGTTGG - Intronic
1161180214 19:2875624-2875646 TGCCATCTTGGAGCCTGTGGAGG - Intronic
1162461290 19:10815804-10815826 TGCCAGCAAGTCCCCAGTGGGGG - Intronic
1162751081 19:12829891-12829913 ATCCTGCTAGAAGCCTGTGGAGG - Exonic
1163364997 19:16870989-16871011 TGGCAGCGAGAATGCTGTGGAGG - Intronic
1165120139 19:33553613-33553635 TGCCACCTATAAGCATGTGGGGG - Intergenic
1165845569 19:38815925-38815947 TTCCAGCAAGAGCCCCGTGGCGG - Exonic
1167050654 19:47075881-47075903 TGCCAGCACAGACCCTGTGGAGG + Intronic
1168172157 19:54596113-54596135 TCCCAGATAGAAGCCTGGGGAGG + Intronic
925706225 2:6686514-6686536 TGACAGCTAGACCTCTGTGAAGG + Intergenic
927035963 2:19176677-19176699 TGCCAGCTAGTTCCTGGTGGGGG + Intergenic
927591457 2:24360900-24360922 TTCCAGGGAGAACCCCGTGGTGG - Intergenic
932144287 2:69305192-69305214 TGGCAGCTACAACTCTGCGGGGG + Intergenic
933153192 2:78939668-78939690 TCCCAGATAGAACAATGTGGTGG - Intergenic
935704612 2:105845015-105845037 TGCCAGCAGGGACCCTGTGTAGG - Intronic
936315477 2:111421008-111421030 AGCCAGGCAGATCCCTGTGGAGG + Intergenic
937973974 2:127569964-127569986 TGCCAGGTAGGACCATGGGGAGG + Intronic
948478931 2:238238800-238238822 TGCCAGCCAGAGTCCTGCGGGGG - Exonic
1169808073 20:9580083-9580105 TGCCAGCACCACCCCTGTGGAGG + Intronic
1169899119 20:10535015-10535037 TCCCAGCTAAAAACCTTTGGAGG - Intronic
1170592389 20:17780790-17780812 TGCCAGCAAGCACCGTGTGCGGG + Intergenic
1170668395 20:18406702-18406724 TACCAGCTTGAACACAGTGGGGG + Intronic
1174190650 20:48738181-48738203 TGCCAGCTGGAACACTGGTGAGG + Intronic
1174527338 20:51184128-51184150 TTCCAGCAACAACTCTGTGGGGG - Intergenic
1174872260 20:54193806-54193828 TGACAGGTAAAAACCTGTGGAGG + Intergenic
1178770767 21:35501583-35501605 TGCAGGCTAGAAGCCTCTGGGGG - Intronic
1179090082 21:38256766-38256788 TGCCCACTAGAATCCTGTGCTGG + Exonic
1179790836 21:43755055-43755077 TGCCAGCTGGCACCCCGAGGAGG + Intronic
1181076933 22:20385083-20385105 TGCCAGTTAGATTTCTGTGGTGG + Intronic
1184260867 22:43315138-43315160 TGCCAGCTTGAAGCCTTTGCTGG + Intronic
950902717 3:16512584-16512606 TGGCAGCAAGAACCGCGTGGAGG - Intronic
954681301 3:52347450-52347472 TCCCAGCTGGAACCCTCTGATGG - Intronic
957548861 3:81677767-81677789 TGGCAGCTAGTACCCTGGGAAGG + Intronic
961101360 3:124201949-124201971 GGCCAGCTGGAGCCCTGTGATGG + Intronic
963349846 3:144138835-144138857 TTCCAGGTAGAGCCCTGGGGAGG - Intergenic
964781417 3:160342630-160342652 TGCCATCTTGGAGCCTGTGGAGG + Intronic
965705749 3:171506209-171506231 TGCCAGCTAAATGCCTGTGAGGG - Intergenic
969040015 4:4288866-4288888 TGCCAGCTAGGCCCCTCAGGTGG - Intronic
980525672 4:133988746-133988768 TGCCAGTTGGGACCCTGTGTGGG + Intergenic
985542088 5:492058-492080 GGACAGGTGGAACCCTGTGGGGG + Exonic
989560258 5:42842251-42842273 TGCCAGCTAGAACCCTGTGGAGG + Intronic
993792507 5:92224355-92224377 TGACAGCTTGCACCGTGTGGTGG - Intergenic
994410393 5:99400833-99400855 TGCCAGCTAGAGTACTGAGGTGG + Intergenic
994483432 5:100364437-100364459 TGCCAGCTAGAGTACTGAGGTGG - Intergenic
995453309 5:112326311-112326333 TGGCAGTTATAACCCTGTGATGG - Intronic
1001225051 5:169936994-169937016 TGGTAGCTTGAACACTGTGGAGG + Intronic
1001256740 5:170189209-170189231 TGTCAGCCAAAACCCTCTGGGGG + Intergenic
1002719305 5:181247961-181247983 TGCCAGCTAAAACTCTGTGCAGG + Intronic
1004790543 6:19021680-19021702 TTCCTGCTAGGACCCTCTGGGGG + Intergenic
1006405301 6:33841565-33841587 TGCCATCTGGAACCGTGGGGTGG - Intergenic
1008547740 6:52598275-52598297 TGCCAGCCACAACCATGTGTGGG - Intergenic
1009600032 6:65787096-65787118 TGCCAGCCAGAAAGCTGTGTGGG - Intergenic
1011298757 6:85852206-85852228 TGCAAGCCAGAACACAGTGGGGG - Intergenic
1013194502 6:107833382-107833404 TCTCCGCTTGAACCCTGTGGAGG + Intergenic
1016681205 6:146831386-146831408 TTCCAGCTAAATACCTGTGGAGG - Intergenic
1019076795 6:169394375-169394397 TGACAGCTAGAACTCTGTGAAGG + Intergenic
1020132952 7:5569892-5569914 TGCCAGCAGGAAACCAGTGGAGG + Intergenic
1020767266 7:12339096-12339118 TACCAGCAAGAAAGCTGTGGAGG + Intronic
1021491018 7:21220196-21220218 TGCCAATTAGAACCCTGTACAGG - Intergenic
1022728076 7:32998654-32998676 TCCCAGCTAGAGCCCCGTGTGGG + Intronic
1025045577 7:55689365-55689387 TCCCAGCTAGAGCCCCGTGTGGG - Intergenic
1025154649 7:56593537-56593559 TGGAAGCCAGAACCCTGTGCTGG + Intergenic
1025763288 7:64415367-64415389 TGGAAGCCAGAACCCTGTGCTGG - Intergenic
1034132400 7:148732114-148732136 AGCAAGCCAGAACCCTGTTGGGG - Intronic
1035875950 8:3189867-3189889 TGCCCGCCAGAACTCTGTGGTGG - Intronic
1039583115 8:38682996-38683018 TGGAGGCCAGAACCCTGTGGAGG + Intergenic
1041846927 8:62340011-62340033 TGTCAGCTAGACCCTTGTGATGG - Intronic
1044414918 8:91926372-91926394 TGCCAGCTAGAATCCTTAGCTGG - Intergenic
1047074117 8:121380501-121380523 TGCCATCTTGGATCCTGTGGAGG - Intergenic
1048875884 8:138836974-138836996 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1048876371 8:138839569-138839591 TCCCAGCTGGAACTCTGTGTGGG - Intronic
1052401997 9:28012171-28012193 TCCCAGCCACTACCCTGTGGTGG - Intronic
1054907154 9:70421202-70421224 TGCCAGCTACCTTCCTGTGGGGG + Intergenic
1057250271 9:93495180-93495202 GACCACTTAGAACCCTGTGGAGG + Intronic
1059212667 9:112528366-112528388 TGCCACCTACCACCCTGTGCAGG + Intronic
1061238921 9:129358031-129358053 TTCCAGCCAGAGCCCTGGGGTGG + Intergenic
1187944381 X:24412088-24412110 TGCCAGTCTGACCCCTGTGGAGG - Intergenic
1193188769 X:78545002-78545024 TGCCAGCAAAAACACTCTGGTGG + Intergenic
1195690241 X:107618288-107618310 AGACAGCTAGAAGCCTGTGATGG - Intergenic