ID: 989562932

View in Genome Browser
Species Human (GRCh38)
Location 5:42872008-42872030
Sequence TATTGTGATGGGAGTAGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989562932_989562941 21 Left 989562932 5:42872008-42872030 CCGCATCTACTCCCATCACAATA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989562941 5:42872052-42872074 GGGATAATCTAATGCAGGAGTGG 0: 1
1: 0
2: 1
3: 7
4: 80
989562932_989562938 0 Left 989562932 5:42872008-42872030 CCGCATCTACTCCCATCACAATA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989562938 5:42872031-42872053 GGGACTTACTGAGATGAGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 224
989562932_989562937 -1 Left 989562932 5:42872008-42872030 CCGCATCTACTCCCATCACAATA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989562937 5:42872030-42872052 AGGGACTTACTGAGATGAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 223
989562932_989562939 1 Left 989562932 5:42872008-42872030 CCGCATCTACTCCCATCACAATA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989562939 5:42872032-42872054 GGACTTACTGAGATGAGAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 218
989562932_989562940 16 Left 989562932 5:42872008-42872030 CCGCATCTACTCCCATCACAATA 0: 1
1: 0
2: 1
3: 15
4: 210
Right 989562940 5:42872047-42872069 AGAAGGGGATAATCTAATGCAGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989562932 Original CRISPR TATTGTGATGGGAGTAGATG CGG (reversed) Intronic
900574634 1:3376996-3377018 TCTTGTGATGGAAGGAGGTGGGG - Intronic
906164926 1:43679015-43679037 TTTTGAGGTGGGAGGAGATGGGG + Intronic
907649600 1:56282404-56282426 AGTTGTGATGGCAGTAGAGGTGG - Intergenic
909613576 1:77580446-77580468 TTTTGAGAGGGGAGTAGAAGTGG - Intronic
910647493 1:89529334-89529356 CCTTGTCATGGGAGGAGATGAGG + Intronic
911046302 1:93631526-93631548 TATTGGGGTGGCAGGAGATGAGG + Intronic
911924522 1:103811854-103811876 CAATGTGATGGTATTAGATGGGG - Intergenic
912348152 1:108985025-108985047 TAATGTGATGGCAGTGGAGGTGG - Intronic
912532447 1:110336039-110336061 TATTGTGAATGGAGTATGTGAGG + Intergenic
915426004 1:155827494-155827516 CTTTGTGAGGGGAGTAGGTGAGG + Intronic
917598436 1:176552667-176552689 TATTTTGACGGGGGTAGTTGGGG - Intronic
918327228 1:183421492-183421514 TAAAGTCATGGGACTAGATGAGG + Intergenic
919763637 1:201113082-201113104 TGTAGGGATGGGAGGAGATGGGG - Intergenic
921287462 1:213622048-213622070 TTTTCTGAGGGGAGGAGATGAGG - Intergenic
923423283 1:233842610-233842632 AATAGGGATGAGAGTAGATGAGG - Intergenic
923937777 1:238782923-238782945 TATTGTGTTGGGAGAAGAGGAGG - Intergenic
1063243785 10:4197301-4197323 TACTGTGAAGGCAGTATATGTGG + Intergenic
1063279130 10:4605358-4605380 TATTGTCATGGCAATAGCTGTGG + Intergenic
1064094201 10:12411092-12411114 TGATGTGATGGGAGCCGATGGGG - Intronic
1065341262 10:24708291-24708313 TATAGTTTTGGGAGTTGATGAGG - Intronic
1065669801 10:28103635-28103657 TTTTGTGTTGGGAGTAGGAGTGG - Intronic
1066045622 10:31593071-31593093 TATTGTGCTGGGAGATGTTGAGG + Intergenic
1068799009 10:61118274-61118296 GATTGTGAATGGAGTAGAGGTGG - Intergenic
1069583067 10:69578256-69578278 TATTATGTTGGGAGAAGGTGAGG - Intergenic
1070481149 10:76884060-76884082 TATTGTGATGGGAATGGAATGGG - Intronic
1070844811 10:79513344-79513366 TAGTGTGAGGGGAGAAGAGGAGG - Exonic
1070928993 10:80246967-80246989 TAGTGTGAGGGGAGAAGAGGAGG + Intergenic
1076690353 10:132220631-132220653 TATTGTGATGGTGGTAGAGATGG - Intronic
1078993942 11:16677726-16677748 ATTTATGATGGGGGTAGATGAGG - Intronic
1082783974 11:57306777-57306799 GATTGTGATGGGACTAGGTTAGG - Intronic
1083937460 11:65877526-65877548 TCTTGTGATGGTAGGGGATGTGG - Intergenic
1084257117 11:67950703-67950725 TATTGTGCTGGGAGTACTTGTGG - Intergenic
1084281030 11:68093966-68093988 TATAGTGATGGGAGTAATGGAGG - Intronic
1084815664 11:71644565-71644587 TACTGTGCTGGGAGTACTTGTGG + Intergenic
1085150303 11:74247252-74247274 TAGTGTGTTAGGAGTAGAGGCGG - Intronic
1085551211 11:77374287-77374309 TATTTTGATGTGGGCAGATGTGG - Intronic
1085757836 11:79216335-79216357 TACTGTGATGGGAGTAGACAAGG + Intronic
1086906375 11:92422654-92422676 TGTTGTGTTGGGTGTAGAAGGGG + Intronic
1090479859 11:127058646-127058668 TGTTGTCATGGTAATAGATGTGG - Intergenic
1091606948 12:1961130-1961152 TATTTTGATGGGTGAAGAAGGGG + Intronic
1092140083 12:6177885-6177907 TACAGTGATGGGGGTAGAAGTGG + Intergenic
1092164301 12:6333516-6333538 TCTGGTGAGGGGAGAAGATGGGG + Exonic
1092427345 12:8385487-8385509 TACTGTGCTGGGAGTACTTGTGG - Intergenic
1093485112 12:19643596-19643618 TAATGGGATAGGGGTAGATGTGG + Intronic
1094443594 12:30506181-30506203 GATTGTGCTGGGAGAAGATCAGG + Intergenic
1096992926 12:55819485-55819507 TATTGTGCTGTGAGTCTATGGGG + Exonic
1097574733 12:61377366-61377388 TAGTGTGTTTGGAGCAGATGAGG + Intergenic
1098853984 12:75631528-75631550 TCTTGTGATTAGAGTGGATGTGG - Intergenic
1101502322 12:105315688-105315710 TATGGTGGTGGGAGTCCATGTGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101981035 12:109407009-109407031 GATGGTGATGGGGGAAGATGAGG - Intronic
1102242157 12:111331400-111331422 TAATGTGCTGGGATTAGGTGTGG + Intronic
1102518818 12:113466722-113466744 TAGTGTGAGGGGAGGGGATGGGG - Intronic
1103143163 12:118569794-118569816 TATTGTGATGTGTCTAGCTGTGG + Intergenic
1104660309 12:130607345-130607367 AATTGTGATCTGAGCAGATGCGG - Intronic
1106215293 13:27692281-27692303 TATTGTGATAACAGTAGATATGG + Intergenic
1106367584 13:29097155-29097177 TATTGTGATGATAGTAGGGGAGG + Intronic
1106704183 13:32263125-32263147 TATACTGATGGGCATAGATGTGG - Intronic
1107576946 13:41734688-41734710 TATGGTGATGGGAGTTGGTTAGG - Intronic
1107726073 13:43300645-43300667 TCAGGTGATGGGAGAAGATGGGG + Intronic
1109542322 13:63795371-63795393 TGTTGTGATGGAAGTATAGGTGG - Intergenic
1111370649 13:87312452-87312474 TCTTGTGATAGGAAAAGATGAGG - Intergenic
1115025509 14:28740543-28740565 TATTGTGATGTGACTACATGTGG + Intergenic
1115437733 14:33394909-33394931 AATGGTGATGGGAGTGGAGGAGG + Intronic
1115487189 14:33922549-33922571 TATTGGGATGAGAGTAGATGGGG + Intergenic
1119364810 14:74082920-74082942 CATTGTGATGGGAGGGGAAGAGG + Intronic
1119365628 14:74089303-74089325 TCTTGAGATGGGAGAAGATTGGG + Intronic
1123509317 15:20980345-20980367 TATTGTAATGGGGGAAGACGGGG + Intergenic
1123566541 15:21554089-21554111 TATTGTAATGGGGGAAGACGGGG + Intergenic
1123602802 15:21991378-21991400 TATTGTAATGGGGGAAGACGGGG + Intergenic
1124457933 15:29861755-29861777 TTTTGTGATGGGGGGAGATTAGG + Intronic
1126807817 15:52370127-52370149 TTTTGTGTACGGAGTAGATGGGG + Intronic
1129918080 15:79292619-79292641 TATTGTAATGGGGGTTGATGAGG - Intergenic
1131043270 15:89293004-89293026 TCTTGTGATGGGAGTTTGTGAGG + Exonic
1131803631 15:96098970-96098992 TATTGGCATAGGAGTAGAAGTGG - Intergenic
1133085943 16:3363588-3363610 TATTGTGGTGGGGGGAGGTGGGG + Intergenic
1133370897 16:5244890-5244912 TACTGTGCTGGGAGTACTTGTGG + Intergenic
1133534960 16:6693070-6693092 GGTTGTGATGGTAGTAGAGGAGG - Intronic
1133822483 16:9248893-9248915 CAGTGTGATGGGCTTAGATGTGG + Intergenic
1136105987 16:28030810-28030832 TATTGGGATGGGTTGAGATGGGG + Intronic
1137619387 16:49866600-49866622 CACTGGGATGGGAGCAGATGGGG + Intergenic
1140409620 16:74734033-74734055 TAATGTGGTGGGAGTAGGAGAGG - Intronic
1141488041 16:84354084-84354106 TATGCTGATGGCAGAAGATGGGG - Intergenic
1141885686 16:86890628-86890650 TCTTTTGATCGGAATAGATGAGG - Intergenic
1143032350 17:3974688-3974710 TAAGGTGCTGGGAGTGGATGTGG - Intergenic
1143495799 17:7312040-7312062 TAGTGTGAGGGGAGAAGAGGAGG - Exonic
1144166804 17:12619903-12619925 TTTTATGATGGGAGCACATGGGG + Intergenic
1146688430 17:34856932-34856954 TCTTAGGATGGGAGTAGAGGAGG + Intergenic
1147131703 17:38413437-38413459 TATTGGAATGGGAGTTTATGTGG + Intergenic
1147391348 17:40111323-40111345 TATTGTGGGGGGAGGAAATGAGG + Intergenic
1153149941 18:2080834-2080856 GATTGAGGTGGGGGTAGATGGGG + Intergenic
1154388795 18:13918909-13918931 TATTTTGATGTGAGAAGGTGTGG + Intergenic
1157321587 18:46639004-46639026 TTCTGTGATGGGATGAGATGAGG + Intronic
1157467512 18:47960068-47960090 TATTCTGGTGGGAGAACATGAGG - Intergenic
1158051022 18:53220097-53220119 TAGTGGGAAGGGAGGAGATGGGG + Intronic
1158128595 18:54128312-54128334 TATTGGGAAGGGACTGGATGGGG - Intergenic
1158160613 18:54478710-54478732 TATGGTGATGGGGGCAGATATGG + Intergenic
1158691381 18:59664247-59664269 TAAGGTGATGGGATTAGGTGGGG - Intronic
1166304592 19:41930505-41930527 TAGTGTGCTGGGTGTAGAGGGGG - Intergenic
1167228088 19:48263134-48263156 TATGATGATAGGAGGAGATGGGG - Intronic
926202344 2:10811188-10811210 TACTGTGGAGAGAGTAGATGAGG - Intronic
926879141 2:17522233-17522255 TTGTGTTGTGGGAGTAGATGTGG - Intergenic
927087569 2:19686945-19686967 TATTTTGATGGGAGGAGTAGAGG - Intergenic
929419361 2:41775309-41775331 TCTTATGATAGAAGTAGATGAGG + Intergenic
930085767 2:47496008-47496030 TATGGGGATGGGAGTAGGGGTGG + Intronic
931181206 2:59902558-59902580 GTTTGCAATGGGAGTAGATGAGG - Intergenic
933505173 2:83168107-83168129 TATTGTGATGGCATTGGTTGAGG + Intergenic
935010519 2:99131162-99131184 TTTTGTGAAGAAAGTAGATGGGG + Intronic
935334606 2:102004898-102004920 GATGGTGGTGGGGGTAGATGAGG + Intronic
936107148 2:109634294-109634316 TATTATGATGTGTGTAGGTGTGG - Intergenic
940780853 2:157932351-157932373 TATTCAGCTGGGGGTAGATGTGG + Intronic
941528552 2:166635725-166635747 TATTGTGATGAAAACAGATGTGG + Intergenic
942023767 2:171893538-171893560 TACTGTGTTGCTAGTAGATGTGG - Intronic
942171329 2:173292193-173292215 CATGGTGATGGGAGTAAATAGGG - Intergenic
942998059 2:182289119-182289141 TGTTGTAATGGGAGTGGGTGGGG - Intronic
943728007 2:191272139-191272161 TCTTGAGATGAGAGTAGATAGGG + Intronic
944081953 2:195797879-195797901 TGTGGTGATTGGAGGAGATGAGG - Intronic
948008727 2:234633511-234633533 TTATGTGAAGTGAGTAGATGGGG - Intergenic
1170007459 20:11684949-11684971 TACTGTAATTGGAGGAGATGTGG + Intergenic
1170917760 20:20644682-20644704 TTTTGTGAAGGGAGAAGTTGGGG - Intronic
1172841455 20:37904708-37904730 TATTCTGATGGGAGTGAGTGGGG + Intronic
1173698978 20:45049793-45049815 AATTGAGATGGGAGGAGAAGTGG - Intronic
1173738635 20:45380040-45380062 AATGGTGGTGGGAGAAGATGAGG + Intronic
1174721386 20:52816680-52816702 TATTGTGATGGTATTAGGAGTGG - Intergenic
1177953958 21:27573809-27573831 GATGGAGATGGGAGTAGAGGTGG + Intergenic
1178611873 21:34089748-34089770 TATTCTGATGGGTGAAGTTGAGG - Intronic
1180749373 22:18113750-18113772 TTTTGTGATGGGAGGGGAGGAGG - Intronic
1181362290 22:22347263-22347285 TGTTGGGATGAGAGTAGATGGGG - Intergenic
1182014154 22:27025135-27025157 TATTGTTATGGGTGTAGGAGGGG + Intergenic
1182407751 22:30152109-30152131 TATTTTGAAGAGAGTAGTTGGGG - Intronic
1182838190 22:33361588-33361610 TAGTGTGAGGGCAGCAGATGGGG + Intronic
1183853090 22:40608525-40608547 GATTGTGGTGGGATTAAATGAGG - Intronic
1184478964 22:44736288-44736310 GGCTGTGATGGGAGCAGATGGGG - Intronic
949295460 3:2516981-2517003 TATTGTGGTTGGAAGAGATGTGG + Intronic
950750444 3:15124018-15124040 TACTGTGCTGGGAGTACTTGTGG + Intergenic
952645712 3:35656110-35656132 TATTTTTAAAGGAGTAGATGAGG + Intronic
952944174 3:38465849-38465871 TACTGTGATGGAAATAGATGTGG - Intronic
953051266 3:39346209-39346231 TATTTGGGTGGGAGTAGGTGGGG + Intergenic
953227433 3:41033543-41033565 TATTGTGATCTGCGTAGGTGAGG - Intergenic
955556222 3:60140291-60140313 TCATGTGAGGGGAGTAGCTGTGG - Intronic
956085782 3:65607727-65607749 TCTTGTGATGGGAACAAATGAGG - Intronic
956105018 3:65808559-65808581 CATTGTGCTGGAAGTAAATGAGG - Intronic
957072060 3:75575183-75575205 TACTGTGCTGGGAGTACTTGTGG - Intergenic
958253747 3:91300588-91300610 TCATGTGTTGGAAGTAGATGAGG - Intergenic
960214989 3:115022650-115022672 TAGTTTGAAGGGAGTAGAGGAGG - Intronic
961535757 3:127569595-127569617 TACTGAGATGTGAGTAGAGGTGG - Intergenic
963674593 3:148293694-148293716 TATTCTGATTGGTGTAGCTGAGG - Intergenic
966778387 3:183562721-183562743 TTTGCTGATGGGAGCAGATGTGG - Intergenic
967281198 3:187825818-187825840 TATTGTCAAGGGAGCAGAAGGGG - Intergenic
969015646 4:4102504-4102526 TACTGTGCTGGGAGTACTTGTGG - Intergenic
969738317 4:9005858-9005880 TACTGTGCTGGGAGTACTTGTGG + Intergenic
969797504 4:9537401-9537423 TACTGTGCTGGGAGTACTTGTGG + Intergenic
970765247 4:19540630-19540652 TAATGTGATGGGATAACATGGGG + Intergenic
970863091 4:20726149-20726171 TTTTGTGGTGGGAGTGGAGGGGG + Intronic
972337781 4:38123100-38123122 TATTTTAATTGGCGTAGATGTGG + Intronic
972404682 4:38734348-38734370 GATGGTGATGGTGGTAGATGTGG + Intergenic
973653408 4:53020552-53020574 TAGGGTCATGGGAGTCGATGAGG - Intronic
973958060 4:56082720-56082742 TATAGAGCTGGGACTAGATGTGG + Intergenic
974358567 4:60844993-60845015 TAAGGTGATGAGAGTTGATGGGG - Intergenic
974571339 4:63653183-63653205 CATTGTAAAGAGAGTAGATGAGG + Intergenic
975075277 4:70199369-70199391 TTTTATAATGGGAGTGGATGTGG - Intronic
975983264 4:80182858-80182880 CTTTGGGATGGGAGTAGATCTGG + Intergenic
976513652 4:85938893-85938915 TAATGTGATGGGAGGAATTGAGG + Intronic
976887288 4:90001199-90001221 GATAGTGATGGTAGTAGAAGCGG - Intergenic
980894245 4:138846179-138846201 TTCTGTGATGGGAGTATGTGGGG + Intergenic
983921454 4:173349969-173349991 TATTGTCATTGGAGAAAATGGGG + Intergenic
984786176 4:183569395-183569417 TGGTGTGATGGGAGTGGATTGGG - Intergenic
985368426 4:189259473-189259495 TATTATTATGTCAGTAGATGCGG - Intergenic
988545937 5:32157316-32157338 TATTGTGCTGGGTGGGGATGAGG - Intronic
989562932 5:42872008-42872030 TATTGTGATGGGAGTAGATGCGG - Intronic
990090973 5:52048247-52048269 TATTGTGAGCTAAGTAGATGTGG - Intronic
990635271 5:57718917-57718939 TATTGTCATGGTCCTAGATGGGG + Intergenic
991335186 5:65539481-65539503 TATTGTGTTGGGAGTTAATTGGG - Intronic
992846468 5:80754191-80754213 TAGTGGGATCTGAGTAGATGTGG - Intronic
998012309 5:138705003-138705025 CATTATGATGGGAGGAGCTGTGG - Intronic
1004238040 6:13892411-13892433 TAGTGTGATGGGAGGTGGTGAGG + Intergenic
1007925281 6:45644981-45645003 TATTGTGAGAGGAGTAGCTTTGG + Intronic
1007950220 6:45865570-45865592 AATGGTGATGGGAGGAGAAGAGG + Intergenic
1008791701 6:55242588-55242610 TATTGTGATGTGATTGGATATGG - Intronic
1009334489 6:62469746-62469768 TATTATTATGGGGATAGATGAGG - Intergenic
1010404910 6:75493756-75493778 TGTTGTGAAGGGAGCAGAAGAGG - Intergenic
1010473044 6:76252344-76252366 TAGAGTGATGGAATTAGATGTGG + Intergenic
1010880226 6:81158619-81158641 TATTTTGATTGATGTAGATGTGG + Intergenic
1013516177 6:110888270-110888292 TATTGTGATGGGCCTTGCTGGGG + Intronic
1015470268 6:133597443-133597465 TAATGTGATGGGATTAGTTTTGG + Intergenic
1016259342 6:142148898-142148920 TATTGTGACTGGAGTGGATGGGG + Intronic
1016947476 6:149547885-149547907 TATTGTGGTGGCAGTCGCTGTGG - Intergenic
1018801386 6:167225207-167225229 TATTGTTATGGGAGGAGAAGTGG - Intergenic
1022477867 7:30723538-30723560 TATGGTGGGGGGAGGAGATGGGG + Intronic
1023346048 7:39272299-39272321 AACTGTGATGGGAGTGGAGGAGG - Intronic
1024203401 7:47129640-47129662 TATTCTGATGGAAGTAGGTGGGG - Intergenic
1024815078 7:53258877-53258899 TATTGTGTTGTGAATACATGAGG + Intergenic
1025715451 7:63951741-63951763 CATTCCCATGGGAGTAGATGGGG - Intergenic
1028503871 7:91550088-91550110 CCTTGGGATGGGAGTAGATGGGG + Intergenic
1029074313 7:97924137-97924159 TACTGTGCTGGGAGTACTTGTGG - Intergenic
1029457468 7:100678481-100678503 TGTTGTCATGGGAGTACATGAGG - Exonic
1030607134 7:111649827-111649849 TATTTTCATGGGAGTGGATGGGG - Intergenic
1030830787 7:114218337-114218359 TATTGTTAGAGTAGTAGATGTGG + Intronic
1030876409 7:114818650-114818672 TAGTGTGATGGGGGTAGTTGTGG - Intergenic
1033265288 7:139880400-139880422 TGCTCTGATGGGAGTATATGAGG - Intronic
1035831339 8:2697556-2697578 TATTGTGATGGGCGCAAAGGAGG - Intergenic
1036111248 8:5905282-5905304 TATTCTGAAGGGAGTAGGAGAGG + Intergenic
1036257419 8:7216916-7216938 TACTGTGCTGGGAGTACTTGTGG - Intergenic
1036309465 8:7675512-7675534 TACTGTGCTGGGAGTACTTGTGG - Intergenic
1036360072 8:8070607-8070629 TACTGTGCTGGGAGTACTTGTGG + Intergenic
1036528455 8:9556687-9556709 TATTGTGATGGGACAAAGTGGGG + Intronic
1038136589 8:24792526-24792548 AATTCTGATGGTAGTAGAAGGGG + Intergenic
1042080979 8:65050609-65050631 TAGGGTCATGGGAGTAGGTGGGG - Intergenic
1042142774 8:65696010-65696032 TATTGTTATGGAAGCAGAGGAGG + Intronic
1044947193 8:97400340-97400362 TATTTTGATCAGAGTAAATGAGG + Intergenic
1045136425 8:99224560-99224582 TAATCTGATGGGATTTGATGAGG + Intronic
1045934279 8:107661047-107661069 TATTGTAATGCCAGAAGATGAGG - Intergenic
1048117127 8:131536505-131536527 AATTATGATGTGACTAGATGTGG + Intergenic
1050111678 9:2223241-2223263 TATTGTGAGGACAGTAGCTGAGG + Intergenic
1053212898 9:36246403-36246425 AATTGTGAGGGGAGAAGATGAGG - Exonic
1054999723 9:71435469-71435491 TATAGTGCTGGCAGTAGAAGAGG - Intronic
1055265302 9:74488719-74488741 TATTGTGATGTGCTTAGGTGTGG - Intergenic
1055893603 9:81149724-81149746 TATTGTGATGTTATTTGATGAGG + Intergenic
1056933458 9:90897695-90897717 GAATGTGATGGGACAAGATGGGG + Exonic
1059682707 9:116601881-116601903 TGTTATGATTGGACTAGATGTGG + Intronic
1060434216 9:123579858-123579880 GATTGTAATGGGGGGAGATGTGG - Intronic
1187400624 X:18956796-18956818 CATTGTGTTGGAAGAAGATGGGG + Intronic
1195736497 X:108018028-108018050 CATTGAGATGGGAGTGGGTGGGG - Intergenic
1195775808 X:108404977-108404999 TTTTGTGTGGGGGGTAGATGAGG - Intronic
1196095559 X:111794835-111794857 CAATGTGATGGTATTAGATGGGG - Intronic
1198425523 X:136516046-136516068 TAATGTGGTGGGAGTAGACATGG - Intergenic
1198812354 X:140548510-140548532 TGTTGTCATGGGGGCAGATGTGG + Intergenic