ID: 989563904

View in Genome Browser
Species Human (GRCh38)
Location 5:42881958-42881980
Sequence TTCTATTAGCAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989563904_989563907 -7 Left 989563904 5:42881958-42881980 CCCTCCTTCTTCTGCTAATAGAA 0: 1
1: 0
2: 2
3: 32
4: 292
Right 989563907 5:42881974-42881996 AATAGAACTTCCCTTTCCTATGG No data
989563904_989563908 -6 Left 989563904 5:42881958-42881980 CCCTCCTTCTTCTGCTAATAGAA 0: 1
1: 0
2: 2
3: 32
4: 292
Right 989563908 5:42881975-42881997 ATAGAACTTCCCTTTCCTATGGG No data
989563904_989563912 20 Left 989563904 5:42881958-42881980 CCCTCCTTCTTCTGCTAATAGAA 0: 1
1: 0
2: 2
3: 32
4: 292
Right 989563912 5:42882001-42882023 AACATCTCACGTGTTTCAAGTGG 0: 1
1: 0
2: 1
3: 8
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989563904 Original CRISPR TTCTATTAGCAGAAGAAGGA GGG (reversed) Intronic
900719953 1:4169330-4169352 TTCTGTGTGCAGAAGAAGCATGG - Intergenic
900719953 1:4169330-4169352 TTCTGTGTGCAGAAGAAGCATGG - Intergenic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901344150 1:8524074-8524096 TTTTATTAAAAGAAGCAGGAAGG + Intronic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
901505856 1:9685250-9685272 TTCTATTAGAATAAACAGGAGGG - Intronic
902041714 1:13497261-13497283 CTCTCATAGCAGAAGAAGGTAGG + Intronic
902041714 1:13497261-13497283 CTCTCATAGCAGAAGAAGGTAGG + Intronic
904179608 1:28656883-28656905 TCCTATTTGGAGAAGAAGGCAGG - Intergenic
904179608 1:28656883-28656905 TCCTATTTGGAGAAGAAGGCAGG - Intergenic
906414964 1:45614409-45614431 ATCTATTAGAGGAAGAACGAGGG - Intronic
906414964 1:45614409-45614431 ATCTATTAGAGGAAGAACGAGGG - Intronic
907148650 1:52260976-52260998 TCCTATTAGGGGAAGAAGCATGG - Intronic
907148650 1:52260976-52260998 TCCTATTAGGGGAAGAAGCATGG - Intronic
907783979 1:57594059-57594081 TTCTGTTATCAGAAGATGAAAGG + Intronic
907783979 1:57594059-57594081 TTCTGTTATCAGAAGATGAAAGG + Intronic
909952948 1:81740957-81740979 TTCTATTACCATAGGAAGGAAGG + Intronic
909952948 1:81740957-81740979 TTCTATTACCATAGGAAGGAAGG + Intronic
910708250 1:90152838-90152860 GTCTATTAGCAGCATAAGAATGG - Intergenic
910708250 1:90152838-90152860 GTCTATTAGCAGCATAAGAATGG - Intergenic
911848281 1:102782834-102782856 GTCTATTAGCAGCATAAGAATGG - Intergenic
911848281 1:102782834-102782856 GTCTATTAGCAGCATAAGAATGG - Intergenic
912233535 1:107822895-107822917 TAATATTAACAGAACAAGGAAGG - Intronic
912233535 1:107822895-107822917 TAATATTAACAGAACAAGGAAGG - Intronic
912690234 1:111799591-111799613 TCCTATTAAGACAAGAAGGAGGG + Intronic
912690234 1:111799591-111799613 TCCTATTAAGACAAGAAGGAGGG + Intronic
917143933 1:171867462-171867484 GGCTATTAGCAGAAGAATCATGG - Intronic
917143933 1:171867462-171867484 GGCTATTAGCAGAAGAATCATGG - Intronic
918528004 1:185486163-185486185 TTCTGTGAGCAGAAGAATGATGG + Intergenic
918528004 1:185486163-185486185 TTCTGTGAGCAGAAGAATGATGG + Intergenic
919798696 1:201337505-201337527 TTCTTTTAGGTGAACAAGGAAGG + Intergenic
919798696 1:201337505-201337527 TTCTTTTAGGTGAACAAGGAAGG + Intergenic
920582368 1:207123420-207123442 TTCTGTTAGCATAAGATAGAGGG + Intronic
920582368 1:207123420-207123442 TTCTGTTAGCATAAGATAGAGGG + Intronic
921183650 1:212651954-212651976 TTCTATTAGCAATAAAGGGAAGG - Intergenic
921183650 1:212651954-212651976 TTCTATTAGCAATAAAGGGAAGG - Intergenic
921452912 1:215330832-215330854 TACTGTTAGCAGAGGAAGAAGGG - Intergenic
921452912 1:215330832-215330854 TACTGTTAGCAGAGGAAGAAGGG - Intergenic
922415156 1:225414814-225414836 TTCTCTCAGCAGAAGACAGATGG + Intronic
922415156 1:225414814-225414836 TTCTCTCAGCAGAAGACAGATGG + Intronic
922710911 1:227831134-227831156 TTATATTAGAAGAAGAAGAAAGG - Intronic
922710911 1:227831134-227831156 TTATATTAGAAGAAGAAGAAAGG - Intronic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
923387343 1:233478359-233478381 CTTTATTAGCAGCATAAGGATGG - Intergenic
923387343 1:233478359-233478381 CTTTATTAGCAGCATAAGGATGG - Intergenic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
924386807 1:243506745-243506767 GTCTATTTGCAGAAGAAGAGAGG - Intronic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1065023969 10:21524532-21524554 TTCTACTGGCAGAATTAGGATGG + Intronic
1065023969 10:21524532-21524554 TTCTACTGGCAGAATTAGGATGG + Intronic
1065048220 10:21763375-21763397 TGCTATTAACATAAGAAAGAGGG + Intronic
1065048220 10:21763375-21763397 TGCTATTAACATAAGAAAGAGGG + Intronic
1068203106 10:53809852-53809874 GTCTAGTGACAGAAGAAGGAAGG - Intronic
1068203106 10:53809852-53809874 GTCTAGTGACAGAAGAAGGAAGG - Intronic
1068942600 10:62694178-62694200 TTCTATTAACAGAAAGAAGAGGG - Intergenic
1068942600 10:62694178-62694200 TTCTATTAACAGAAAGAAGAGGG - Intergenic
1070764267 10:79047517-79047539 TTCTATAGGCAGCAGAAGGGAGG - Intergenic
1070764267 10:79047517-79047539 TTCTATAGGCAGCAGAAGGGAGG - Intergenic
1071989928 10:91091808-91091830 TTCTATTAACAGAAGAAATGAGG - Intergenic
1071989928 10:91091808-91091830 TTCTATTAACAGAAGAAATGAGG - Intergenic
1072014500 10:91333491-91333513 TGCTGTTAACAGAAGAAAGAAGG + Intergenic
1072014500 10:91333491-91333513 TGCTGTTAACAGAAGAAAGAAGG + Intergenic
1072337668 10:94413434-94413456 TACAAATAGCAGCAGAAGGAAGG - Intronic
1072337668 10:94413434-94413456 TACAAATAGCAGCAGAAGGAAGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1073737379 10:106365076-106365098 TTTTTTTAGCTGAAGTAGGAGGG - Intergenic
1073737379 10:106365076-106365098 TTTTTTTAGCTGAAGTAGGAGGG - Intergenic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1076201005 10:128557876-128557898 TTCTATGAGCAGAGTAATGAAGG + Intergenic
1076201005 10:128557876-128557898 TTCTATGAGCAGAGTAATGAAGG + Intergenic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1078157334 11:8810353-8810375 TTCTATTAGCTTAAGGAGGAGGG - Intronic
1078291468 11:10014718-10014740 TTCAATTAGGATAAGAAGAAAGG - Intronic
1078291468 11:10014718-10014740 TTCAATTAGGATAAGAAGAAAGG - Intronic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079697841 11:23505857-23505879 TTCTATCAGAAGAAGAAGTCTGG + Intergenic
1079697841 11:23505857-23505879 TTCTATCAGAAGAAGAAGTCTGG + Intergenic
1079849915 11:25519038-25519060 TCCTCTCATCAGAAGAAGGAAGG + Intergenic
1079849915 11:25519038-25519060 TCCTCTCATCAGAAGAAGGAAGG + Intergenic
1081149704 11:39612157-39612179 TTCTATTAACCATAGAAGGAAGG + Intergenic
1081149704 11:39612157-39612179 TTCTATTAACCATAGAAGGAAGG + Intergenic
1081516759 11:43839494-43839516 TTGTATTATCAGAAGAAGATGGG + Intronic
1081516759 11:43839494-43839516 TTGTATTATCAGAAGAAGATGGG + Intronic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1083957466 11:65993063-65993085 TTCTATTACCAGAAAAAGTGGGG - Intergenic
1083957466 11:65993063-65993085 TTCTATTACCAGAAAAAGTGGGG - Intergenic
1085554843 11:77410905-77410927 TTAACTTAGCAGAATAAGGAAGG + Intronic
1085554843 11:77410905-77410927 TTAACTTAGCAGAATAAGGAAGG + Intronic
1085560708 11:77471177-77471199 TTCTATTGGCAAGAGAGGGATGG + Intronic
1085560708 11:77471177-77471199 TTCTATTGGCAAGAGAGGGATGG + Intronic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1086656050 11:89356719-89356741 ATCTACTAGAAGAAGAAAGAGGG - Intronic
1086656050 11:89356719-89356741 ATCTACTAGAAGAAGAAAGAGGG - Intronic
1086686493 11:89739564-89739586 TTCAAATTGCAGGAGAAGGATGG - Intergenic
1086686493 11:89739564-89739586 TTCAAATTGCAGGAGAAGGATGG - Intergenic
1087688295 11:101290240-101290262 TTCTTTCAGCAGAAGAGGGATGG - Intergenic
1087688295 11:101290240-101290262 TTCTTTCAGCAGAAGAGGGATGG - Intergenic
1087721897 11:101675277-101675299 TTCTATTGCCAGAATATGGAGGG - Intronic
1087721897 11:101675277-101675299 TTCTATTGCCAGAATATGGAGGG - Intronic
1088651315 11:111959860-111959882 ATCTATTGGCCAAAGAAGGAAGG + Intronic
1088651315 11:111959860-111959882 ATCTATTGGCCAAAGAAGGAAGG + Intronic
1088689923 11:112317012-112317034 TTCTCTCAGCAGGTGAAGGAAGG + Intergenic
1088689923 11:112317012-112317034 TTCTCTCAGCAGGTGAAGGAAGG + Intergenic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089639139 11:119835716-119835738 TTCTTCAAGCAGAAGCAGGAGGG - Intergenic
1089639139 11:119835716-119835738 TTCTTCAAGCAGAAGCAGGAGGG - Intergenic
1091039861 11:132267012-132267034 TTCAAATAGCAGAGGAAAGACGG + Intronic
1091039861 11:132267012-132267034 TTCAAATAGCAGAGGAAAGACGG + Intronic
1092626331 12:10333431-10333453 TTCTATTAATATAAGAAGGCAGG - Intergenic
1092626331 12:10333431-10333453 TTCTATTAATATAAGAAGGCAGG - Intergenic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093952449 12:25178996-25179018 TTATATTAGAAGAAGAAAAAAGG - Intronic
1093952449 12:25178996-25179018 TTATATTAGAAGAAGAAAAAAGG - Intronic
1096899266 12:54857889-54857911 CTCTCTTACCAGAAGAAGGCTGG + Intronic
1096899266 12:54857889-54857911 CTCTCTTACCAGAAGAAGGCTGG + Intronic
1097448829 12:59711225-59711247 TACTGTTCCCAGAAGAAGGAAGG + Intronic
1097448829 12:59711225-59711247 TACTGTTCCCAGAAGAAGGAAGG + Intronic
1097693346 12:62754701-62754723 TTCTTTTAGCTGGACAAGGAAGG - Intronic
1097693346 12:62754701-62754723 TTCTTTTAGCTGGACAAGGAAGG - Intronic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1099252402 12:80272551-80272573 TTTCATTACCAGAAGAGGGAGGG - Intronic
1099252402 12:80272551-80272573 TTTCATTACCAGAAGAGGGAGGG - Intronic
1100370877 12:93967265-93967287 TTTTCTTAGTACAAGAAGGAGGG - Intergenic
1100370877 12:93967265-93967287 TTTTCTTAGTACAAGAAGGAGGG - Intergenic
1100959629 12:99947956-99947978 TGCTATTAGAAGAAGAAGTCAGG - Intronic
1100959629 12:99947956-99947978 TGCTATTAGAAGAAGAAGTCAGG - Intronic
1101256501 12:102982683-102982705 TTCTATTACCATGAAAAGGAAGG + Intergenic
1101256501 12:102982683-102982705 TTCTATTACCATGAAAAGGAAGG + Intergenic
1103132279 12:118479658-118479680 TGTTCTTAGGAGAAGAAGGAGGG + Intergenic
1103132279 12:118479658-118479680 TGTTCTTAGGAGAAGAAGGAGGG + Intergenic
1104103674 12:125639157-125639179 TTTTATTGGCAGGGGAAGGAGGG - Intronic
1104103674 12:125639157-125639179 TTTTATTGGCAGGGGAAGGAGGG - Intronic
1106185794 13:27408635-27408657 TTCTATTTCCAGAAGAAGCCTGG + Intergenic
1106185794 13:27408635-27408657 TTCTATTTCCAGAAGAAGCCTGG + Intergenic
1107183942 13:37495386-37495408 CTCATTTAGCAGAAGAAGCATGG + Intergenic
1107183942 13:37495386-37495408 CTCATTTAGCAGAAGAAGCATGG + Intergenic
1108048223 13:46403517-46403539 TTCTATTGACAGAAGAGAGAAGG - Intronic
1108048223 13:46403517-46403539 TTCTATTGACAGAAGAGAGAAGG - Intronic
1109158835 13:58946721-58946743 TTGTATTAACAGATGAAGTAGGG - Intergenic
1109158835 13:58946721-58946743 TTGTATTAACAGATGAAGTAGGG - Intergenic
1109225450 13:59689127-59689149 TTCTTGCAGCAGAAGAAAGAAGG - Intronic
1109225450 13:59689127-59689149 TTCTTGCAGCAGAAGAAAGAAGG - Intronic
1109782622 13:67131896-67131918 TTCTATGATCAGAACAAGGATGG - Intronic
1109782622 13:67131896-67131918 TTCTATGATCAGAACAAGGATGG - Intronic
1110931278 13:81221139-81221161 TTCTAATATCATAAGAATGAAGG - Intergenic
1110931278 13:81221139-81221161 TTCTAATATCATAAGAATGAAGG - Intergenic
1111158863 13:84366551-84366573 TTCTCTTAGAAGAAGCAGGCTGG - Intergenic
1111158863 13:84366551-84366573 TTCTCTTAGAAGAAGCAGGCTGG - Intergenic
1111571060 13:90087044-90087066 TACTATTAGCAGCAATAGGAGGG + Intergenic
1111571060 13:90087044-90087066 TACTATTAGCAGCAATAGGAGGG + Intergenic
1113626173 13:111848861-111848883 TGCTATTAGCAGAAGATAGCTGG - Intergenic
1113626173 13:111848861-111848883 TGCTATTAGCAGAAGATAGCTGG - Intergenic
1114320528 14:21543692-21543714 TTCATTCAGCAGAAGATGGAAGG + Intergenic
1114320528 14:21543692-21543714 TTCATTCAGCAGAAGATGGAAGG + Intergenic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1115530611 14:34323580-34323602 TTCTACTAGAAGACGGAGGAAGG - Intronic
1115530611 14:34323580-34323602 TTCTACTAGAAGACGGAGGAAGG - Intronic
1116419539 14:44716836-44716858 TTATATTTTCAGAAGAAGTATGG + Intergenic
1116419539 14:44716836-44716858 TTATATTTTCAGAAGAAGTATGG + Intergenic
1116515307 14:45797608-45797630 TACTGTTAACAGAAGAAGGGAGG - Intergenic
1116515307 14:45797608-45797630 TACTGTTAACAGAAGAAGGGAGG - Intergenic
1116735862 14:48690697-48690719 TTTTCTTGGTAGAAGAAGGATGG - Intergenic
1116735862 14:48690697-48690719 TTTTCTTGGTAGAAGAAGGATGG - Intergenic
1118436195 14:65772859-65772881 TTCTTTTTGAAGAAGCAGGAGGG + Intergenic
1118436195 14:65772859-65772881 TTCTTTTTGAAGAAGCAGGAGGG + Intergenic
1118596489 14:67439380-67439402 TTCTCTCAGCTGCAGAAGGAGGG + Intergenic
1118596489 14:67439380-67439402 TTCTCTCAGCTGCAGAAGGAGGG + Intergenic
1118609017 14:67525511-67525533 TTATGTTAGGAGAAGAATGAGGG - Intronic
1118609017 14:67525511-67525533 TTATGTTAGGAGAAGAATGAGGG - Intronic
1120486484 14:85120422-85120444 TTCTATTTGCAGAGCAATGATGG + Intergenic
1120486484 14:85120422-85120444 TTCTATTTGCAGAGCAATGATGG + Intergenic
1121283602 14:92717298-92717320 TTCTAGAAACAGAAGAAAGAGGG + Intronic
1121283602 14:92717298-92717320 TTCTAGAAACAGAAGAAAGAGGG + Intronic
1124115065 15:26833622-26833644 GTCAATTAGCAGTATAAGGAAGG + Intronic
1124115065 15:26833622-26833644 GTCAATTAGCAGTATAAGGAAGG + Intronic
1125210300 15:37206998-37207020 TGCTATGAGTAGAAGAATGAAGG + Intergenic
1125210300 15:37206998-37207020 TGCTATGAGTAGAAGAATGAAGG + Intergenic
1125692276 15:41605831-41605853 TTCTATTAGCAGAAGAAAATAGG + Intergenic
1125692276 15:41605831-41605853 TTCTATTAGCAGAAGAAAATAGG + Intergenic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127254564 15:57278312-57278334 TACTATTAGCTGCAGAAGAAAGG + Intronic
1127254564 15:57278312-57278334 TACTATTAGCTGCAGAAGAAAGG + Intronic
1132189270 15:99836434-99836456 TTATTTTAGCATAAGAGGGATGG - Intergenic
1132189270 15:99836434-99836456 TTATTTTAGCATAAGAGGGATGG - Intergenic
1132943119 16:2518309-2518331 TTCTCTTGGGAGAGGAAGGAGGG + Intronic
1132943119 16:2518309-2518331 TTCTCTTGGGAGAGGAAGGAGGG + Intronic
1135655607 16:24246109-24246131 TGCTGTTACCAGAAGAAGGTTGG - Intergenic
1135655607 16:24246109-24246131 TGCTGTTACCAGAAGAAGGTTGG - Intergenic
1136191614 16:28618861-28618883 TTCTATTTGCAAAATAAGGATGG - Intronic
1136191614 16:28618861-28618883 TTCTATTTGCAAAATAAGGATGG - Intronic
1136999761 16:35218202-35218224 TTCTGTGATCAGAAGAAAGAAGG - Intergenic
1136999761 16:35218202-35218224 TTCTGTGATCAGAAGAAAGAAGG - Intergenic
1137388478 16:48061464-48061486 TGCTATTAACTGAATAAGGAAGG - Intergenic
1137388478 16:48061464-48061486 TGCTATTAACTGAATAAGGAAGG - Intergenic
1138322118 16:56124162-56124184 TTCAAATTGCAGAAGAAGAAAGG + Intergenic
1138322118 16:56124162-56124184 TTCAAATTGCAGAAGAAGAAAGG + Intergenic
1139191948 16:64874477-64874499 TACTATTAGCAGTAAAAGGAAGG - Intergenic
1139191948 16:64874477-64874499 TACTATTAGCAGTAAAAGGAAGG - Intergenic
1141732395 16:85831433-85831455 TTCAATTAGTAGCAGAAGGTAGG - Intergenic
1141732395 16:85831433-85831455 TTCAATTAGTAGCAGAAGGTAGG - Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1142923548 17:3212609-3212631 TTCTATTTGAAGAAGGGGGAGGG + Intergenic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143304973 17:5939329-5939351 TGCTGTTGGCAGAAGAAGGGAGG - Intronic
1143304973 17:5939329-5939351 TGCTGTTGGCAGAAGAAGGGAGG - Intronic
1143767906 17:9149692-9149714 ATCTATCAGCAAAAGAAGGAAGG - Intronic
1143767906 17:9149692-9149714 ATCTATCAGCAAAAGAAGGAAGG - Intronic
1146840162 17:36146487-36146509 TTGTATTAGGAGATGATGGAGGG - Intergenic
1146840162 17:36146487-36146509 TTGTATTAGGAGATGATGGAGGG - Intergenic
1147482800 17:40782938-40782960 TCATAGTATCAGAAGAAGGAGGG + Intergenic
1147482800 17:40782938-40782960 TCATAGTATCAGAAGAAGGAGGG + Intergenic
1148168103 17:45497939-45497961 TTCTATTACCAGAAGACAAAGGG - Intergenic
1148168103 17:45497939-45497961 TTCTATTACCAGAAGACAAAGGG - Intergenic
1148280713 17:46345021-46345043 TTCTATTACCAGAAGACAAAGGG + Intronic
1148280713 17:46345021-46345043 TTCTATTACCAGAAGACAAAGGG + Intronic
1148302941 17:46562956-46562978 TTCTATTACCAGAAGACAAAGGG + Intronic
1148302941 17:46562956-46562978 TTCTATTACCAGAAGACAAAGGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1150204503 17:63392069-63392091 TTCTATCAGAAGAAGAAGAGAGG - Intronic
1150474647 17:65465683-65465705 TTCTATTTGCAGTAGAATGAGGG + Intergenic
1150474647 17:65465683-65465705 TTCTATTTGCAGTAGAATGAGGG + Intergenic
1153326353 18:3824294-3824316 TTCTATTGGCAGCAAGAGGAAGG - Intronic
1153326353 18:3824294-3824316 TTCTATTGGCAGCAAGAGGAAGG - Intronic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1156054644 18:32985789-32985811 TTATGGTAGCAGTAGAAGGAAGG + Intronic
1156054644 18:32985789-32985811 TTATGGTAGCAGTAGAAGGAAGG + Intronic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1156831501 18:41497546-41497568 TACTAGAAGCAGAAGAAGCAGGG - Intergenic
1156831501 18:41497546-41497568 TACTAGAAGCAGAAGAAGCAGGG - Intergenic
1158183143 18:54740893-54740915 TTTTATTAACAGAAGAAAGGAGG + Intronic
1158183143 18:54740893-54740915 TTTTATTAACAGAAGAAAGGAGG + Intronic
1159995194 18:74957664-74957686 TTCTATTATGAGAGGAAGGAAGG + Intronic
1159995194 18:74957664-74957686 TTCTATTATGAGAGGAAGGAAGG + Intronic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1163249785 19:16119718-16119740 TGCTAAGAGCAGAAGCAGGAAGG - Intronic
1163249785 19:16119718-16119740 TGCTAAGAGCAGAAGCAGGAAGG - Intronic
1164506065 19:28862471-28862493 TTCGATGAGCAGAGGAGGGAAGG - Intergenic
1164506065 19:28862471-28862493 TTCGATGAGCAGAGGAGGGAAGG - Intergenic
1165372612 19:35418952-35418974 TGCTGCTACCAGAAGAAGGAGGG - Intergenic
1165372612 19:35418952-35418974 TGCTGCTACCAGAAGAAGGAGGG - Intergenic
1167746014 19:51352251-51352273 TTCTATGAGCAGAAGAGGGGTGG - Intronic
1167746014 19:51352251-51352273 TTCTATGAGCAGAAGAGGGGTGG - Intronic
1168704324 19:58460135-58460157 TTCTTCTTGCAGAAGAAGTAGGG - Intergenic
1168704324 19:58460135-58460157 TTCTTCTTGCAGAAGAAGTAGGG - Intergenic
926552311 2:14315462-14315484 TTCTGTTAGCAGAAGATAAAAGG + Intergenic
926552311 2:14315462-14315484 TTCTGTTAGCAGAAGATAAAAGG + Intergenic
926698069 2:15784581-15784603 TTCCATTCTCAGAAGAAGGTGGG + Intergenic
926698069 2:15784581-15784603 TTCCATTCTCAGAAGAAGGTGGG + Intergenic
927664608 2:25021929-25021951 TGATATTACCAGAAGAGGGAAGG - Intergenic
927664608 2:25021929-25021951 TGATATTACCAGAAGAGGGAAGG - Intergenic
930500628 2:52212845-52212867 TTCCTTAAGCAGAAGAAGGTGGG - Intergenic
930500628 2:52212845-52212867 TTCCTTAAGCAGAAGAAGGTGGG - Intergenic
931642079 2:64390698-64390720 TAGTATTAGAAAAAGAAGGAAGG - Intergenic
931642079 2:64390698-64390720 TAGTATTAGAAAAAGAAGGAAGG - Intergenic
932290176 2:70570568-70570590 TTCTAATAGAATTAGAAGGAGGG - Intergenic
932290176 2:70570568-70570590 TTCTAATAGAATTAGAAGGAGGG - Intergenic
932995587 2:76847613-76847635 TTCTATTTGTAAAAGAAGAAAGG + Intronic
932995587 2:76847613-76847635 TTCTATTTGTAAAAGAAGAAAGG + Intronic
933601213 2:84332723-84332745 TTCATTTAAAAGAAGAAGGAAGG + Intergenic
933601213 2:84332723-84332745 TTCATTTAAAAGAAGAAGGAAGG + Intergenic
933752581 2:85612346-85612368 TCCTATTACCAGAAAAAAGATGG - Intronic
933752581 2:85612346-85612368 TCCTATTACCAGAAAAAAGATGG - Intronic
933909182 2:86924044-86924066 ATCTACCAGCAGAAGAAGGATGG - Intronic
933909182 2:86924044-86924066 ATCTACCAGCAGAAGAAGGATGG - Intronic
933928772 2:87126624-87126646 ATCTACCAGCAGAAGAAGGATGG - Intergenic
933928772 2:87126624-87126646 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934000105 2:87702409-87702431 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934000105 2:87702409-87702431 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934023542 2:87979341-87979363 ATCTACCAGCAGAAGAAGGATGG + Intergenic
934023542 2:87979341-87979363 ATCTACCAGCAGAAGAAGGATGG + Intergenic
935503732 2:103873200-103873222 TTAGGTTAGCAGACGAAGGAAGG - Intergenic
935503732 2:103873200-103873222 TTAGGTTAGCAGACGAAGGAAGG - Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
935995824 2:108771814-108771836 TTCTTGTAGCAGAAGAAAGTTGG - Exonic
935995824 2:108771814-108771836 TTCTTGTAGCAGAAGAAAGTTGG - Exonic
935999588 2:108813978-108814000 GTCTATCAACAGAAGAATGAAGG - Intronic
935999588 2:108813978-108814000 GTCTATCAACAGAAGAATGAAGG - Intronic
938382923 2:130846685-130846707 TTTCTTTAGCAGAAGGAGGAAGG + Intronic
938382923 2:130846685-130846707 TTTCTTTAGCAGAAGGAGGAAGG + Intronic
939489359 2:142858380-142858402 TTTTATTGGCATAAGAATGAAGG - Intergenic
939489359 2:142858380-142858402 TTTTATTGGCATAAGAATGAAGG - Intergenic
940608791 2:155964013-155964035 TTCTATTATAAGAAAACGGAAGG - Intergenic
940608791 2:155964013-155964035 TTCTATTATAAGAAAACGGAAGG - Intergenic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
941094133 2:161216328-161216350 TTCAATTAGCAGAAGCAAGAAGG - Intronic
941094133 2:161216328-161216350 TTCAATTAGCAGAAGCAAGAAGG - Intronic
941191478 2:162389210-162389232 ATCTATTAGCAAAAGTAAGAGGG + Intronic
941191478 2:162389210-162389232 ATCTATTAGCAAAAGTAAGAGGG + Intronic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942739535 2:179159063-179159085 TTCTTTTAGAAAAAGAATGAAGG + Intronic
942739535 2:179159063-179159085 TTCTTTTAGAAAAAGAATGAAGG + Intronic
943356970 2:186867919-186867941 TTCTGTTACTAAAAGAAGGAAGG + Intergenic
943356970 2:186867919-186867941 TTCTGTTACTAAAAGAAGGAAGG + Intergenic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
944037420 2:195311891-195311913 TACTATTTGAAGAAGAAAGATGG - Intergenic
944037420 2:195311891-195311913 TACTATTTGAAGAAGAAAGATGG - Intergenic
944856681 2:203775001-203775023 TCCTAATAGGAGAAAAAGGAAGG + Intergenic
944856681 2:203775001-203775023 TCCTAATAGGAGAAAAAGGAAGG + Intergenic
946204637 2:218094934-218094956 TTTTATTAAGAAAAGAAGGAAGG + Intergenic
946204637 2:218094934-218094956 TTTTATTAAGAAAAGAAGGAAGG + Intergenic
947210853 2:227707265-227707287 TTCTACCAGCAAAAGAAGAAAGG - Intronic
947210853 2:227707265-227707287 TTCTACCAGCAAAAGAAGAAAGG - Intronic
1168824414 20:799932-799954 TGATATTAGCAGAAAGAGGAGGG + Intergenic
1168824414 20:799932-799954 TGATATTAGCAGAAAGAGGAGGG + Intergenic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1173287905 20:41689549-41689571 TTCTATTGGTAGAAGAAGCCAGG + Intergenic
1173287905 20:41689549-41689571 TTCTATTGGTAGAAGAAGCCAGG + Intergenic
1174660095 20:52204960-52204982 TCCTGTTATCAGAAGTAGGAAGG - Intergenic
1174660095 20:52204960-52204982 TCCTGTTATCAGAAGTAGGAAGG - Intergenic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177209199 21:18049176-18049198 TTCTATTACCAGTTGAATGAGGG + Intronic
1177209199 21:18049176-18049198 TTCTATTACCAGTTGAATGAGGG + Intronic
1177822154 21:26043110-26043132 TTCCATGGGCAGAAGAGGGATGG - Intronic
1177822154 21:26043110-26043132 TTCCATGGGCAGAAGAGGGATGG - Intronic
1177933611 21:27316323-27316345 TTCTTTTAGCAGAAAGGGGATGG + Intergenic
1177933611 21:27316323-27316345 TTCTTTTAGCAGAAAGGGGATGG + Intergenic
1178119083 21:29449851-29449873 CTCTCTTAACAGAAGAATGATGG - Intronic
1178119083 21:29449851-29449873 CTCTCTTAACAGAAGAATGATGG - Intronic
1178556323 21:33593469-33593491 TTTTATTAACAGCAGTAGGAAGG - Intronic
1178556323 21:33593469-33593491 TTTTATTAACAGCAGTAGGAAGG - Intronic
1178769043 21:35485137-35485159 TGCCATTAGCAAAAGTAGGATGG - Intronic
1178769043 21:35485137-35485159 TGCCATTAGCAAAAGTAGGATGG - Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
949514552 3:4795213-4795235 TCCTATTAGAAGCAGCAGGAAGG + Intronic
949514552 3:4795213-4795235 TCCTATTAGAAGCAGCAGGAAGG + Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
950312028 3:11967132-11967154 TTCTATTACCAGAAGCAGCGAGG + Intergenic
950312028 3:11967132-11967154 TTCTATTACCAGAAGCAGCGAGG + Intergenic
951043215 3:18011088-18011110 CTCTATTAACTGATGAAGGAAGG - Intronic
951043215 3:18011088-18011110 CTCTATTAACTGATGAAGGAAGG - Intronic
951115948 3:18861951-18861973 TTCTATTATAAGAAGAAAGGGGG + Intergenic
951115948 3:18861951-18861973 TTCTATTATAAGAAGAAAGGGGG + Intergenic
952515701 3:34102973-34102995 TACTATCAGGAGAAGAACGAAGG + Intergenic
952515701 3:34102973-34102995 TACTATCAGGAGAAGAACGAAGG + Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
953405727 3:42658917-42658939 TTCTTTAAGGAGGAGAAGGAGGG + Exonic
954413924 3:50383700-50383722 TTCTATGCCCAGGAGAAGGAGGG + Intronic
954413924 3:50383700-50383722 TTCTATGCCCAGGAGAAGGAGGG + Intronic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
957608608 3:82437156-82437178 TTATTTTAGGATAAGAAGGAAGG - Intergenic
957608608 3:82437156-82437178 TTATTTTAGGATAAGAAGGAAGG - Intergenic
958559807 3:95731943-95731965 TTCTATTTTCAGTAGAAGAATGG - Intergenic
958559807 3:95731943-95731965 TTCTATTTTCAGTAGAAGAATGG - Intergenic
958933488 3:100232419-100232441 TTCTATTAAAAAAAGTAGGAGGG + Intergenic
958933488 3:100232419-100232441 TTCTATTAAAAAAAGTAGGAGGG + Intergenic
960163997 3:114381168-114381190 TTCTAGTAGCTAAAGAGGGAAGG + Intronic
960163997 3:114381168-114381190 TTCTAGTAGCTAAAGAGGGAAGG + Intronic
960384755 3:117009299-117009321 TTCTCTTAGAAGAAAAAGAAAGG - Intronic
960384755 3:117009299-117009321 TTCTCTTAGAAGAAAAAGAAAGG - Intronic
961367832 3:126412574-126412596 TTCCATTAACAGAATAAAGAAGG - Intronic
961367832 3:126412574-126412596 TTCCATTAACAGAATAAAGAAGG - Intronic
962431195 3:135321989-135322011 TTCTGTTTGCAGAAGAAAGAAGG + Intergenic
962431195 3:135321989-135322011 TTCTGTTTGCAGAAGAAAGAAGG + Intergenic
964409687 3:156384836-156384858 TTCTTCTGGCAGGAGAAGGAGGG + Intronic
964409687 3:156384836-156384858 TTCTTCTGGCAGGAGAAGGAGGG + Intronic
966243422 3:177779771-177779793 TTCTGTTAGAAAAAGGAGGAAGG + Intergenic
966243422 3:177779771-177779793 TTCTGTTAGAAAAAGGAGGAAGG + Intergenic
966388862 3:179430389-179430411 TTCTATTATAAGAGAAAGGAAGG - Intronic
966388862 3:179430389-179430411 TTCTATTATAAGAGAAAGGAAGG - Intronic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
970548651 4:17156363-17156385 TTCTATTAGGAACAGAAGAAAGG - Intergenic
970548651 4:17156363-17156385 TTCTATTAGGAACAGAAGAAAGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
973311892 4:48718721-48718743 GCCTATGAGCACAAGAAGGAGGG - Intronic
973311892 4:48718721-48718743 GCCTATGAGCACAAGAAGGAGGG - Intronic
973578709 4:52319185-52319207 TTCTATTACTAAAAGAAAGAAGG - Intergenic
973578709 4:52319185-52319207 TTCTATTACTAAAAGAAAGAAGG - Intergenic
974607302 4:64169996-64170018 TTCTATAAACTGAAGAAAGAAGG + Intergenic
974607302 4:64169996-64170018 TTCTATAAACTGAAGAAAGAAGG + Intergenic
974653918 4:64793569-64793591 TTCTATGTGCAGAAGAAATAAGG + Intergenic
974653918 4:64793569-64793591 TTCTATGTGCAGAAGAAATAAGG + Intergenic
975676634 4:76833618-76833640 TGCTATTACCAGAAGAAGGTGGG - Intergenic
975676634 4:76833618-76833640 TGCTATTACCAGAAGAAGGTGGG - Intergenic
978387406 4:108190054-108190076 TTATATTATCAGAAAAAGGCAGG - Intergenic
978387406 4:108190054-108190076 TTATATTATCAGAAAAAGGCAGG - Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
979992068 4:127387224-127387246 TGCTAGGAGCAGAAGAGGGATGG - Intergenic
979992068 4:127387224-127387246 TGCTAGGAGCAGAAGAGGGATGG - Intergenic
980914320 4:139020395-139020417 TTCTAATAGGTGAAAAAGGAGGG + Intronic
980914320 4:139020395-139020417 TTCTAATAGGTGAAAAAGGAGGG + Intronic
985499762 5:235486-235508 TTCTATTACCGGAGGATGGAGGG + Intronic
985499762 5:235486-235508 TTCTATTACCGGAGGATGGAGGG + Intronic
987137929 5:14917173-14917195 TTCTCTCAGCAGAAGAATCATGG - Intergenic
987137929 5:14917173-14917195 TTCTCTCAGCAGAAGAATCATGG - Intergenic
987622019 5:20346941-20346963 ATCTCTTAGCAGAAAAATGAGGG + Intronic
987622019 5:20346941-20346963 ATCTCTTAGCAGAAAAATGAGGG + Intronic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
987939849 5:24519902-24519924 TTCCAGTAGCAGAAGCAGCAAGG - Intronic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
991243543 5:64485237-64485259 TTCTGTTACCAGAAGCGGGAAGG + Intergenic
991243543 5:64485237-64485259 TTCTGTTACCAGAAGCGGGAAGG + Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
993291099 5:86071675-86071697 TTCTATCAGCTGAAGAAGTGAGG + Intergenic
993291099 5:86071675-86071697 TTCTATCAGCTGAAGAAGTGAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994684997 5:102939196-102939218 TTCTATTGGGAGAAATAGGAAGG - Intronic
994684997 5:102939196-102939218 TTCTATTGGGAGAAATAGGAAGG - Intronic
994849069 5:105030177-105030199 AACTATTAGGAGAAGAAAGAAGG - Intergenic
994849069 5:105030177-105030199 AACTATTAGGAGAAGAAAGAAGG - Intergenic
997098765 5:130944352-130944374 TTGTATTAGCATAACAAGAAAGG - Intergenic
997098765 5:130944352-130944374 TTGTATTAGCATAACAAGAAAGG - Intergenic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
997910851 5:137871575-137871597 TACTGTGATCAGAAGAAGGAAGG + Intronic
997910851 5:137871575-137871597 TACTGTGATCAGAAGAAGGAAGG + Intronic
998213879 5:140222882-140222904 TTCTAATAGCAGAAGTAAAAAGG + Intronic
998213879 5:140222882-140222904 TTCTAATAGCAGAAGTAAAAAGG + Intronic
999822343 5:155240447-155240469 TTCCTGTAGCAGAAGAAGGAGGG - Intergenic
999822343 5:155240447-155240469 TTCCTGTAGCAGAAGAAGGAGGG - Intergenic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1005092946 6:22078398-22078420 TTGTATTAGGAGAAGCATGATGG - Intergenic
1005472386 6:26173925-26173947 TTGTATTATCAGAAGAAGATAGG + Intergenic
1005472386 6:26173925-26173947 TTGTATTATCAGAAGAAGATAGG + Intergenic
1005853511 6:29841393-29841415 TTCTACTTGCAGAAGAACAAAGG + Intergenic
1005853511 6:29841393-29841415 TTCTACTTGCAGAAGAACAAAGG + Intergenic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006056598 6:31389688-31389710 TTCTAATATCAGAAGAGGGCTGG - Intergenic
1006056598 6:31389688-31389710 TTCTAATATCAGAAGAGGGCTGG - Intergenic
1006069322 6:31486667-31486689 TTCTAATATCAGAAGAGGGCTGG - Intergenic
1006069322 6:31486667-31486689 TTCTAATATCAGAAGAGGGCTGG - Intergenic
1006474003 6:34243768-34243790 TTCTAGGAGCAGGAGAGGGAGGG - Intronic
1006474003 6:34243768-34243790 TTCTAGGAGCAGGAGAGGGAGGG - Intronic
1008120374 6:47608890-47608912 TTTTATTAACAGAAGAAAAAAGG - Intronic
1008120374 6:47608890-47608912 TTTTATTAACAGAAGAAAAAAGG - Intronic
1008524001 6:52389412-52389434 TTCAATAAGCAGAAGAGAGAAGG + Intronic
1008524001 6:52389412-52389434 TTCAATAAGCAGAAGAGAGAAGG + Intronic
1011101796 6:83730023-83730045 TTCTTTTAGCAGAAGAAGCCAGG + Intergenic
1011101796 6:83730023-83730045 TTCTTTTAGCAGAAGAAGCCAGG + Intergenic
1011376906 6:86697175-86697197 TTCTATTAGCATAGGAAGGTTGG + Intergenic
1011376906 6:86697175-86697197 TTCTATTAGCATAGGAAGGTTGG + Intergenic
1016292816 6:142542342-142542364 GCTTATTAGCAGAAGAAGGTGGG + Intergenic
1016292816 6:142542342-142542364 GCTTATTAGCAGAAGAAGGTGGG + Intergenic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1017591522 6:155983118-155983140 TTCTGTTAGGAGGAGAAGGAAGG - Intergenic
1017591522 6:155983118-155983140 TTCTGTTAGGAGGAGAAGGAAGG - Intergenic
1018054902 6:160043389-160043411 TTCTATAATCACATGAAGGATGG + Intronic
1018054902 6:160043389-160043411 TTCTATAATCACATGAAGGATGG + Intronic
1018884105 6:167918035-167918057 TTCTTTTTGAAGGAGAAGGAGGG + Intronic
1018884105 6:167918035-167918057 TTCTTTTTGAAGGAGAAGGAGGG + Intronic
1019142033 6:169954438-169954460 CTCTTTTGGCAGAAGAGGGATGG - Intergenic
1019142033 6:169954438-169954460 CTCTTTTGGCAGAAGAGGGATGG - Intergenic
1020595613 7:10203725-10203747 TGAAATTAGCAGAAGAAAGAGGG + Intergenic
1020595613 7:10203725-10203747 TGAAATTAGCAGAAGAAAGAGGG + Intergenic
1024192339 7:47025342-47025364 TTCTACTAGCAGAAGGAAGTCGG + Intergenic
1024192339 7:47025342-47025364 TTCTACTAGCAGAAGGAAGTCGG + Intergenic
1027898262 7:84074169-84074191 TTTGATTAGCAGAAGAATGAGGG - Intronic
1027898262 7:84074169-84074191 TTTGATTAGCAGAAGAATGAGGG - Intronic
1028354458 7:89888631-89888653 TTCTATAAGAAGAGGAGGGATGG - Intergenic
1028354458 7:89888631-89888653 TTCTATAAGAAGAGGAGGGATGG - Intergenic
1028717649 7:93991174-93991196 TTCAAATACCAGAAGATGGAAGG + Intronic
1028717649 7:93991174-93991196 TTCAAATACCAGAAGATGGAAGG + Intronic
1029853667 7:103490774-103490796 TGCTGTTAGAAGAGGAAGGAAGG + Exonic
1029853667 7:103490774-103490796 TGCTGTTAGAAGAGGAAGGAAGG + Exonic
1030016661 7:105229477-105229499 TTATGTTAGCACAAAAAGGATGG - Intronic
1030016661 7:105229477-105229499 TTATGTTAGCACAAAAAGGATGG - Intronic
1031595308 7:123643184-123643206 TTCTAGGAACAGGAGAAGGAAGG + Intergenic
1031595308 7:123643184-123643206 TTCTAGGAACAGGAGAAGGAAGG + Intergenic
1031895690 7:127346107-127346129 CTCTATTATCACAAAAAGGAAGG + Intergenic
1031895690 7:127346107-127346129 CTCTATTATCACAAAAAGGAAGG + Intergenic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1032635297 7:133700702-133700724 TTTTATTAGCTGAAGGAGGTTGG + Intronic
1033171465 7:139088274-139088296 TTCTATTACTAGAAGAAAGACGG - Intronic
1033171465 7:139088274-139088296 TTCTATTACTAGAAGAAAGACGG - Intronic
1034859231 7:154581880-154581902 TTCTAGCAGCAGGAGAAGGCAGG - Intronic
1034859231 7:154581880-154581902 TTCTAGCAGCAGGAGAAGGCAGG - Intronic
1034910036 7:154988345-154988367 TTCTATGAGCTTAGGAAGGATGG - Intronic
1034910036 7:154988345-154988367 TTCTATGAGCTTAGGAAGGATGG - Intronic
1034943799 7:155249205-155249227 ATCTACCAGCTGAAGAAGGAGGG - Intergenic
1034943799 7:155249205-155249227 ATCTACCAGCTGAAGAAGGAGGG - Intergenic
1035052258 7:156005632-156005654 CTCTCTTTGCAGCAGAAGGAGGG + Intergenic
1035052258 7:156005632-156005654 CTCTCTTTGCAGCAGAAGGAGGG + Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1039675335 8:39658503-39658525 TTCTATGAGCTGAAAAAGGCAGG + Intronic
1039675335 8:39658503-39658525 TTCTATGAGCTGAAAAAGGCAGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1042041747 8:64599035-64599057 TTGTTTTAGCTGAAAAAGGAAGG + Intronic
1042041747 8:64599035-64599057 TTGTTTTAGCTGAAAAAGGAAGG + Intronic
1042328614 8:67554989-67555011 TGCTATCAGCAGAAGAGGGCTGG + Intronic
1042328614 8:67554989-67555011 TGCTATCAGCAGAAGAGGGCTGG + Intronic
1042534004 8:69840778-69840800 TTCAATAAGCAGAAGCAGCAAGG - Intergenic
1042534004 8:69840778-69840800 TTCAATAAGCAGAAGCAGCAAGG - Intergenic
1043050705 8:75381887-75381909 TTTTTCTAGAAGAAGAAGGATGG - Intergenic
1043050705 8:75381887-75381909 TTTTTCTAGAAGAAGAAGGATGG - Intergenic
1043159171 8:76824426-76824448 TTCTCTTACCAGAAGGTGGATGG + Intronic
1043159171 8:76824426-76824448 TTCTCTTACCAGAAGGTGGATGG + Intronic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1044928236 8:97227296-97227318 GTCTCTTAGCAGCAGAAGGCAGG - Intergenic
1044928236 8:97227296-97227318 GTCTCTTAGCAGCAGAAGGCAGG - Intergenic
1045556919 8:103223441-103223463 TTCTATTATCTGAAAAATGAAGG - Intronic
1045556919 8:103223441-103223463 TTCTATTATCTGAAAAATGAAGG - Intronic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1046435799 8:114187908-114187930 TTCTATTTGTAGAAGAATCACGG + Intergenic
1046435799 8:114187908-114187930 TTCTATTTGTAGAAGAATCACGG + Intergenic
1046876907 8:119265063-119265085 TTGTATTACCAGAACAAAGAAGG - Intergenic
1046876907 8:119265063-119265085 TTGTATTACCAGAACAAAGAAGG - Intergenic
1048006242 8:130421574-130421596 TTCCACTGGCAGAAGAGGGAAGG - Intronic
1048006242 8:130421574-130421596 TTCCACTGGCAGAAGAGGGAAGG - Intronic
1048234520 8:132676422-132676444 CTCCATTTGCAGAAAAAGGAGGG + Intergenic
1048234520 8:132676422-132676444 CTCCATTTGCAGAAAAAGGAGGG + Intergenic
1048777273 8:137961129-137961151 TTCCAGTAGGAGAAGAAGGGTGG + Intergenic
1048777273 8:137961129-137961151 TTCCAGTAGGAGAAGAAGGGTGG + Intergenic
1049990710 9:989094-989116 TTATATGAAAAGAAGAAGGAGGG - Intronic
1049990710 9:989094-989116 TTATATGAAAAGAAGAAGGAGGG - Intronic
1050008513 9:1160274-1160296 TTCCATTTTCAAAAGAAGGAAGG - Intergenic
1050008513 9:1160274-1160296 TTCCATTTTCAAAAGAAGGAAGG - Intergenic
1051265400 9:15304730-15304752 TTCCCTTATCTGAAGAAGGAGGG - Intronic
1051265400 9:15304730-15304752 TTCCCTTATCTGAAGAAGGAGGG - Intronic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1052544191 9:29852363-29852385 TTCTGTTGGCAGTAGAAGGAAGG + Intergenic
1052544191 9:29852363-29852385 TTCTGTTGGCAGTAGAAGGAAGG + Intergenic
1053021648 9:34698951-34698973 AACTGTTAGCAGAAGAAGCATGG - Intergenic
1053021648 9:34698951-34698973 AACTGTTAGCAGAAGAAGCATGG - Intergenic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1053292354 9:36889629-36889651 GTCTAGAAGCAGGAGAAGGATGG - Intronic
1054858685 9:69927861-69927883 TCCTGATAGCAGAAAAAGGATGG - Intergenic
1054858685 9:69927861-69927883 TCCTGATAGCAGAAAAAGGATGG - Intergenic
1055377449 9:75665166-75665188 TTCTAGGAGCAGAACCAGGAAGG - Intergenic
1055377449 9:75665166-75665188 TTCTAGGAGCAGAACCAGGAAGG - Intergenic
1055493067 9:76825961-76825983 TTCTATTTTGAGAAGATGGAAGG - Intronic
1055493067 9:76825961-76825983 TTCTATTTTGAGAAGATGGAAGG - Intronic
1055518291 9:77055097-77055119 TTCTAGTAGCAAAAGAAGATGGG - Intergenic
1055518291 9:77055097-77055119 TTCTAGTAGCAAAAGAAGATGGG - Intergenic
1057219207 9:93246905-93246927 CTCTTTTATCAGAAGAAAGAAGG + Intronic
1057219207 9:93246905-93246927 CTCTTTTATCAGAAGAAAGAAGG + Intronic
1058474685 9:105319965-105319987 TTCTAAGAGCAAAAGAAGTATGG - Intronic
1058474685 9:105319965-105319987 TTCTAAGAGCAAAAGAAGTATGG - Intronic
1059135924 9:111806440-111806462 TTCTATTAGCAGAGACAGGGAGG - Intergenic
1059135924 9:111806440-111806462 TTCTATTAGCAGAGACAGGGAGG - Intergenic
1059589014 9:115637550-115637572 TTCCACTAACAGAGGAAGGAAGG + Intergenic
1059589014 9:115637550-115637572 TTCCACTAACAGAGGAAGGAAGG + Intergenic
1060457676 9:123815617-123815639 TTCTAATAGCTGAGAAAGGAAGG + Intronic
1060457676 9:123815617-123815639 TTCTAATAGCTGAGAAAGGAAGG + Intronic
1060459774 9:123839734-123839756 TTGTATTTGCACAAGAATGAGGG - Intronic
1060459774 9:123839734-123839756 TTGTATTTGCACAAGAATGAGGG - Intronic
1186655478 X:11607457-11607479 TTCTATTAGGGAAAGAAGTATGG - Intronic
1186655478 X:11607457-11607479 TTCTATTAGGGAAAGAAGTATGG - Intronic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1186876064 X:13819396-13819418 TTCTATATGTAGAAGTAGGATGG + Intronic
1187200566 X:17130119-17130141 TTTTATTAACAGCTGAAGGAGGG - Intronic
1187200566 X:17130119-17130141 TTTTATTAACAGCTGAAGGAGGG - Intronic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1187811590 X:23184418-23184440 TTATATTAGAAAAAGAAGAAAGG - Intergenic
1187811590 X:23184418-23184440 TTATATTAGAAAAAGAAGAAAGG - Intergenic
1189497900 X:41526163-41526185 ATCTATGAGCATAGGAAGGAAGG - Intronic
1189497900 X:41526163-41526185 ATCTATGAGCATAGGAAGGAAGG - Intronic
1189668127 X:43379229-43379251 TTCTAGCAGTAGAAGAAAGAAGG + Intergenic
1189668127 X:43379229-43379251 TTCTAGCAGTAGAAGAAAGAAGG + Intergenic
1193025262 X:76839896-76839918 TTTTATTAGCAGAATCAGAATGG - Intergenic
1193025262 X:76839896-76839918 TTTTATTAGCAGAATCAGAATGG - Intergenic
1193992356 X:88323612-88323634 TTGTAGTATCAGAAGAGGGAAGG - Intergenic
1193992356 X:88323612-88323634 TTGTAGTATCAGAAGAGGGAAGG - Intergenic
1196589816 X:117473078-117473100 TTGTATTACCGGAGGAAGGATGG - Intergenic
1196589816 X:117473078-117473100 TTGTATTACCGGAGGAAGGATGG - Intergenic
1196965785 X:121053477-121053499 TGCTGTTATCAGAAGAAGAAGGG - Intergenic
1196965785 X:121053477-121053499 TGCTGTTATCAGAAGAAGAAGGG - Intergenic
1197583593 X:128315360-128315382 TTCTATTAAAAAAAGAAAGATGG + Intergenic
1197583593 X:128315360-128315382 TTCTATTAAAAAAAGAAAGATGG + Intergenic
1197922183 X:131607032-131607054 TTCTCATAGAACAAGAAGGATGG - Intergenic
1197922183 X:131607032-131607054 TTCTCATAGAACAAGAAGGATGG - Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1202038128 Y:20655929-20655951 TTCCATTCACAGGAGAAGGAAGG + Intergenic
1202038128 Y:20655929-20655951 TTCCATTCACAGGAGAAGGAAGG + Intergenic