ID: 989565035

View in Genome Browser
Species Human (GRCh38)
Location 5:42893741-42893763
Sequence TTTACCTTGCTAATTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565035_989565036 2 Left 989565035 5:42893741-42893763 CCTGAAGCAATTAGCAAGGTAAA No data
Right 989565036 5:42893766-42893788 AGTGTTAATCCCCACATGATTGG No data
989565035_989565037 9 Left 989565035 5:42893741-42893763 CCTGAAGCAATTAGCAAGGTAAA No data
Right 989565037 5:42893773-42893795 ATCCCCACATGATTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565035 Original CRISPR TTTACCTTGCTAATTGCTTC AGG (reversed) Intergenic
No off target data available for this crispr