ID: 989565176

View in Genome Browser
Species Human (GRCh38)
Location 5:42894477-42894499
Sequence GGACCCTCTTGCCGTCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565171_989565176 -5 Left 989565171 5:42894459-42894481 CCCGAGGCACCCCAGTGGGGACC No data
Right 989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG No data
989565164_989565176 23 Left 989565164 5:42894431-42894453 CCCGCTTCAACTGCTGTTCTGGA No data
Right 989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG No data
989565165_989565176 22 Left 989565165 5:42894432-42894454 CCGCTTCAACTGCTGTTCTGGAA No data
Right 989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG No data
989565172_989565176 -6 Left 989565172 5:42894460-42894482 CCGAGGCACCCCAGTGGGGACCC No data
Right 989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565176 Original CRISPR GGACCCTCTTGCCGTCCCTG CGG Intergenic
No off target data available for this crispr