ID: 989565352

View in Genome Browser
Species Human (GRCh38)
Location 5:42895977-42895999
Sequence GGGGCAGTGGACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565352_989565354 -8 Left 989565352 5:42895977-42895999 CCAGCACAGTGGTCCACTGCCCC No data
Right 989565354 5:42895992-42896014 ACTGCCCCTTCCCACTCTGTTGG No data
989565352_989565360 15 Left 989565352 5:42895977-42895999 CCAGCACAGTGGTCCACTGCCCC No data
Right 989565360 5:42896015-42896037 TATCATCCACAACTATACAAAGG No data
989565352_989565362 23 Left 989565352 5:42895977-42895999 CCAGCACAGTGGTCCACTGCCCC No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565352 Original CRISPR GGGGCAGTGGACCACTGTGC TGG (reversed) Intergenic
No off target data available for this crispr