ID: 989565353

View in Genome Browser
Species Human (GRCh38)
Location 5:42895990-42896012
Sequence AACAGAGTGGGAAGGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565353_989565360 2 Left 989565353 5:42895990-42896012 CCACTGCCCCTTCCCACTCTGTT No data
Right 989565360 5:42896015-42896037 TATCATCCACAACTATACAAAGG No data
989565353_989565362 10 Left 989565353 5:42895990-42896012 CCACTGCCCCTTCCCACTCTGTT No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565353 Original CRISPR AACAGAGTGGGAAGGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr