ID: 989565354

View in Genome Browser
Species Human (GRCh38)
Location 5:42895992-42896014
Sequence ACTGCCCCTTCCCACTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565350_989565354 24 Left 989565350 5:42895945-42895967 CCAGGGAGGTCATGGTCAGTTTC No data
Right 989565354 5:42895992-42896014 ACTGCCCCTTCCCACTCTGTTGG No data
989565352_989565354 -8 Left 989565352 5:42895977-42895999 CCAGCACAGTGGTCCACTGCCCC No data
Right 989565354 5:42895992-42896014 ACTGCCCCTTCCCACTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565354 Original CRISPR ACTGCCCCTTCCCACTCTGT TGG Intergenic
No off target data available for this crispr