ID: 989565358

View in Genome Browser
Species Human (GRCh38)
Location 5:42896002-42896024
Sequence GTGGATGATACCAACAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565358_989565360 -10 Left 989565358 5:42896002-42896024 CCCACTCTGTTGGTATCATCCAC No data
Right 989565360 5:42896015-42896037 TATCATCCACAACTATACAAAGG No data
989565358_989565362 -2 Left 989565358 5:42896002-42896024 CCCACTCTGTTGGTATCATCCAC No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565358 Original CRISPR GTGGATGATACCAACAGAGT GGG (reversed) Intergenic
No off target data available for this crispr