ID: 989565362

View in Genome Browser
Species Human (GRCh38)
Location 5:42896023-42896045
Sequence ACAACTATACAAAGGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989565352_989565362 23 Left 989565352 5:42895977-42895999 CCAGCACAGTGGTCCACTGCCCC No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565355_989565362 4 Left 989565355 5:42895996-42896018 CCCCTTCCCACTCTGTTGGTATC No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565353_989565362 10 Left 989565353 5:42895990-42896012 CCACTGCCCCTTCCCACTCTGTT No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565356_989565362 3 Left 989565356 5:42895997-42896019 CCCTTCCCACTCTGTTGGTATCA No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565359_989565362 -3 Left 989565359 5:42896003-42896025 CCACTCTGTTGGTATCATCCACA No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565357_989565362 2 Left 989565357 5:42895998-42896020 CCTTCCCACTCTGTTGGTATCAT No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data
989565358_989565362 -2 Left 989565358 5:42896002-42896024 CCCACTCTGTTGGTATCATCCAC No data
Right 989565362 5:42896023-42896045 ACAACTATACAAAGGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989565362 Original CRISPR ACAACTATACAAAGGCACCC TGG Intergenic
No off target data available for this crispr