ID: 989566614

View in Genome Browser
Species Human (GRCh38)
Location 5:42907391-42907413
Sequence TTGTTAACTCAGAAGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989566608_989566614 21 Left 989566608 5:42907347-42907369 CCTGGAATTGTCTGATCTGGAGT No data
Right 989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989566614 Original CRISPR TTGTTAACTCAGAAGGCACA AGG Intergenic
No off target data available for this crispr