ID: 989567591

View in Genome Browser
Species Human (GRCh38)
Location 5:42916447-42916469
Sequence CAGCTGGGTGGATCACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989567582_989567591 16 Left 989567582 5:42916408-42916430 CCTTTGAGGAGCTGTGGATACTA No data
Right 989567591 5:42916447-42916469 CAGCTGGGTGGATCACTTGCTGG No data
989567580_989567591 24 Left 989567580 5:42916400-42916422 CCAGGGGGCCTTTGAGGAGCTGT No data
Right 989567591 5:42916447-42916469 CAGCTGGGTGGATCACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989567591 Original CRISPR CAGCTGGGTGGATCACTTGC TGG Intergenic
No off target data available for this crispr