ID: 989567946

View in Genome Browser
Species Human (GRCh38)
Location 5:42919775-42919797
Sequence TTGTCAACTCAGAAGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989567946_989567948 -8 Left 989567946 5:42919775-42919797 CCTTGTGCCTTCTGAGTTGACAA No data
Right 989567948 5:42919790-42919812 GTTGACAACCACAGAGTTCCAGG No data
989567946_989567952 21 Left 989567946 5:42919775-42919797 CCTTGTGCCTTCTGAGTTGACAA No data
Right 989567952 5:42919819-42919841 ACTCTAGATCTGACAATTCCAGG No data
989567946_989567949 -7 Left 989567946 5:42919775-42919797 CCTTGTGCCTTCTGAGTTGACAA No data
Right 989567949 5:42919791-42919813 TTGACAACCACAGAGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989567946 Original CRISPR TTGTCAACTCAGAAGGCACA AGG (reversed) Intergenic
No off target data available for this crispr