ID: 989568943

View in Genome Browser
Species Human (GRCh38)
Location 5:42927226-42927248
Sequence CTTTGGGAGTCCAAAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568943_989568961 25 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568961 5:42927274-42927296 CATGCAGTGGGGAGGCTGGGGGG No data
989568943_989568956 21 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568943_989568952 13 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568952 5:42927262-42927284 GACGTGAGCCACCATGCAGTGGG No data
989568943_989568953 14 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568953 5:42927263-42927285 ACGTGAGCCACCATGCAGTGGGG No data
989568943_989568954 17 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568954 5:42927266-42927288 TGAGCCACCATGCAGTGGGGAGG No data
989568943_989568963 29 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568963 5:42927278-42927300 CAGTGGGGAGGCTGGGGGGCGGG No data
989568943_989568957 22 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568957 5:42927271-42927293 CACCATGCAGTGGGGAGGCTGGG No data
989568943_989568951 12 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568951 5:42927261-42927283 AGACGTGAGCCACCATGCAGTGG No data
989568943_989568960 24 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568960 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
989568943_989568958 23 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568958 5:42927272-42927294 ACCATGCAGTGGGGAGGCTGGGG No data
989568943_989568962 28 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568962 5:42927277-42927299 GCAGTGGGGAGGCTGGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568943 Original CRISPR CTTTGGGAGTCCAAAGGGGG CGG (reversed) Intergenic