ID: 989568950

View in Genome Browser
Species Human (GRCh38)
Location 5:42927243-42927265
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568950_989568964 27 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data
989568950_989568951 -5 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568951 5:42927261-42927283 AGACGTGAGCCACCATGCAGTGG No data
989568950_989568958 6 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568958 5:42927272-42927294 ACCATGCAGTGGGGAGGCTGGGG No data
989568950_989568961 8 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568961 5:42927274-42927296 CATGCAGTGGGGAGGCTGGGGGG No data
989568950_989568962 11 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568962 5:42927277-42927299 GCAGTGGGGAGGCTGGGGGGCGG No data
989568950_989568953 -3 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568953 5:42927263-42927285 ACGTGAGCCACCATGCAGTGGGG No data
989568950_989568957 5 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568957 5:42927271-42927293 CACCATGCAGTGGGGAGGCTGGG No data
989568950_989568963 12 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568963 5:42927278-42927300 CAGTGGGGAGGCTGGGGGGCGGG No data
989568950_989568952 -4 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568952 5:42927262-42927284 GACGTGAGCCACCATGCAGTGGG No data
989568950_989568960 7 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568960 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
989568950_989568956 4 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568950_989568954 0 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568954 5:42927266-42927288 TGAGCCACCATGCAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568950 Original CRISPR CGTCTGCAATCCAAGCACTT TGG (reversed) Intergenic