ID: 989568956

View in Genome Browser
Species Human (GRCh38)
Location 5:42927270-42927292
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568950_989568956 4 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568946_989568956 16 Left 989568946 5:42927231-42927253 CCCTTTGGACTCCCAAAGTGCTT No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568947_989568956 15 Left 989568947 5:42927232-42927254 CCTTTGGACTCCCAAAGTGCTTG No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568945_989568956 17 Left 989568945 5:42927230-42927252 CCCCTTTGGACTCCCAAAGTGCT No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568949_989568956 5 Left 989568949 5:42927242-42927264 CCCAAAGTGCTTGGATTGCAGAC No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568944_989568956 18 Left 989568944 5:42927229-42927251 CCCCCTTTGGACTCCCAAAGTGC No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
989568943_989568956 21 Left 989568943 5:42927226-42927248 CCGCCCCCTTTGGACTCCCAAAG No data
Right 989568956 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type