ID: 989568959

View in Genome Browser
Species Human (GRCh38)
Location 5:42927273-42927295
Sequence CCCCCAGCCTCCCCACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568959_989568965 18 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568965 5:42927314-42927336 GGCTGACTTTGAAATCCCCTTGG No data
989568959_989568964 -3 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data
989568959_989568967 30 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568967 5:42927326-42927348 AATCCCCTTGGCTGAGAGAAGGG No data
989568959_989568966 29 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568966 5:42927325-42927347 AAATCCCCTTGGCTGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568959 Original CRISPR CCCCCAGCCTCCCCACTGCA TGG (reversed) Intergenic