ID: 989568964

View in Genome Browser
Species Human (GRCh38)
Location 5:42927293-42927315
Sequence GGGGCGGGAACTGCTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568959_989568964 -3 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data
989568949_989568964 28 Left 989568949 5:42927242-42927264 CCCAAAGTGCTTGGATTGCAGAC No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data
989568955_989568964 0 Left 989568955 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data
989568950_989568964 27 Left 989568950 5:42927243-42927265 CCAAAGTGCTTGGATTGCAGACG No data
Right 989568964 5:42927293-42927315 GGGGCGGGAACTGCTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568964 Original CRISPR GGGGCGGGAACTGCTTTTTC AGG Intergenic