ID: 989568965

View in Genome Browser
Species Human (GRCh38)
Location 5:42927314-42927336
Sequence GGCTGACTTTGAAATCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568959_989568965 18 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568965 5:42927314-42927336 GGCTGACTTTGAAATCCCCTTGG No data
989568955_989568965 21 Left 989568955 5:42927270-42927292 CCACCATGCAGTGGGGAGGCTGG No data
Right 989568965 5:42927314-42927336 GGCTGACTTTGAAATCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568965 Original CRISPR GGCTGACTTTGAAATCCCCT TGG Intergenic