ID: 989568966 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:42927325-42927347 |
| Sequence | AAATCCCCTTGGCTGAGAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989568959_989568966 | 29 | Left | 989568959 | 5:42927273-42927295 | CCATGCAGTGGGGAGGCTGGGGG | No data | ||
| Right | 989568966 | 5:42927325-42927347 | AAATCCCCTTGGCTGAGAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989568966 | Original CRISPR | AAATCCCCTTGGCTGAGAGA AGG | Intergenic | ||