ID: 989568967

View in Genome Browser
Species Human (GRCh38)
Location 5:42927326-42927348
Sequence AATCCCCTTGGCTGAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989568959_989568967 30 Left 989568959 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG No data
Right 989568967 5:42927326-42927348 AATCCCCTTGGCTGAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989568967 Original CRISPR AATCCCCTTGGCTGAGAGAA GGG Intergenic