ID: 989575628

View in Genome Browser
Species Human (GRCh38)
Location 5:42985494-42985516
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 6, 1: 27, 2: 45, 3: 72, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989575619_989575628 14 Left 989575619 5:42985457-42985479 CCTTCAAATTCATCATTCCAGAG No data
Right 989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG 0: 6
1: 27
2: 45
3: 72
4: 290
989575622_989575628 -3 Left 989575622 5:42985474-42985496 CCAGAGAGTTCTGGGCTACAGTT No data
Right 989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG 0: 6
1: 27
2: 45
3: 72
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904267933 1:29328508-29328530 GGTTGTTAGGGGATTGTGCAAGG - Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
907844219 1:58189413-58189435 GAATTTAAGTGGTTTGTGGAAGG + Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908056936 1:60297918-60297940 GTTTTTAAGAGTACTGTGGTCGG - Intergenic
908912601 1:69089474-69089496 GTTTTTTAGGGGGATGGGGAAGG + Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
913049656 1:115106143-115106165 GTGTTTAATGGGATGCTGGAAGG + Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917268126 1:173243369-173243391 GCTCTTAAGAGGACTGTGGAGGG - Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918623671 1:186633848-186633870 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920929752 1:210376345-210376367 GAATGTAAGGGGATTGTGAATGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1067168402 10:43883674-43883696 GTTTTTAAGGGCATTGTTCTGGG - Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1069022368 10:63503256-63503278 GTTTTTTAGGGGTTTTTGGGGGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG + Intergenic
1071040416 10:81302172-81302194 GTTTTCAAGGGGAATGTTGCTGG - Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1071371897 10:84959927-84959949 GTTTTTAAGGGGTTTGGAGTGGG - Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072121338 10:92407792-92407814 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075855215 10:125624228-125624250 GTTCTTAGGGGGATAGTGAATGG - Intronic
1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG + Exonic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081185074 11:40032475-40032497 GTTTTTAAGGATAGTTTGGAGGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG + Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1085992754 11:81870122-81870144 GTTGTTAAGCGTATTGTGGGTGG - Intergenic
1086157532 11:83684056-83684078 GTTTTTATGGGTTTTGTGGTAGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086785102 11:90958996-90959018 GTTTTTATGGTAATTGTGAATGG - Intergenic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1088588012 11:111377072-111377094 TTTTTAAAGGGGATGCTGGAGGG - Intronic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089932350 11:122326184-122326206 GTTTTAGAGGGGGTTGTTGATGG + Intergenic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090127345 11:124101026-124101048 TTTTTTGAGGGGGGTGTGGAAGG + Intergenic
1090644224 11:128754661-128754683 GTTTTTGAGCAGATTGTGGCAGG + Intronic
1091700634 12:2658283-2658305 ATTTTTAAGTAGATTTTGGAGGG - Intronic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093195779 12:16128125-16128147 GTTCATAAGGTGAGTGTGGAGGG + Intergenic
1093260017 12:16924413-16924435 GGTTTTTGGGGGATTGTGGGGGG - Intergenic
1093843479 12:23936250-23936272 GTTTTAAAGAAGTTTGTGGAGGG - Intronic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095267760 12:40180290-40180312 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1097136096 12:56857072-56857094 GTTTTTAAGGAGAGTTTGGTGGG + Intergenic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099799553 12:87440485-87440507 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1101259653 12:103015223-103015245 GTTTTGTTGGGCATTGTGGAAGG - Intergenic
1101912617 12:108871809-108871831 GTTTTTAAGGGTAATTTGGTGGG - Intronic
1102740762 12:115205574-115205596 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1103243080 12:119431269-119431291 GTTTTTAAGGATAATTTGGAGGG + Intronic
1104197378 12:126554030-126554052 GTTTTTAAGGATATTTTGGTGGG + Intergenic
1104650010 12:130524676-130524698 GGTGTTAAGGGGATTGAAGAAGG + Intronic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1107694335 13:42985881-42985903 GTTTTTAAGGGGATTCATGGAGG - Intronic
1107868584 13:44727111-44727133 GTTTTTAAGGGTAATTTGGTGGG - Intergenic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1112105162 13:96232022-96232044 GTTCTGAAGGGGAGTGTGGTAGG + Intronic
1112590081 13:100754911-100754933 GTTTTAAATGGGATTGATGAAGG - Intergenic
1114505095 14:23204794-23204816 ATTTTGATGGGGATTGTGTATGG + Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG + Intergenic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121118755 14:91362311-91362333 GTTGGAAAGGGGATTGTGGCTGG - Intronic
1122297980 14:100716176-100716198 GTGTTTATGGGCATTGAGGAAGG + Intergenic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1126774265 15:52086458-52086480 GTTTTTAAGAGAATTATGAAGGG - Intergenic
1127213885 15:56803799-56803821 ATTTTTAAGGAGATTGAGAAAGG - Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG + Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131379063 15:91948865-91948887 GTTATTAAAGGAATTGAGGATGG - Intronic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1134396389 16:13868249-13868271 GTTTCTCAGGGGTTTGAGGAAGG - Intergenic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137071380 16:35907649-35907671 GTTTTTAAGGATAATGCGGAAGG + Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG + Intronic
1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG + Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1146120409 17:30188975-30188997 TTTTTTGAGGGGGGTGTGGAGGG + Intergenic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1148021470 17:44556747-44556769 GTTTTTTAAGGGTGTGTGGAGGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149816118 17:59725376-59725398 GTTTTCAAGGGAATTTTGAAAGG + Intronic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1150292121 17:63988108-63988130 GATTTTAGGGGGCTTGGGGAAGG - Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156014465 18:32532472-32532494 GTGCTTGAGGGGATTGAGGAAGG + Intergenic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157737845 18:50066286-50066308 GTTTGTATGGGGATAGTGGTAGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1161757609 19:6145808-6145830 GTTGTTGAGGGGGTTGTTGAGGG - Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1168249122 19:55131462-55131484 GTTTTTGAGGGGCTAGGGGACGG - Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG + Intronic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933073256 2:77889281-77889303 GTTTTTAAGGATAATTTGGAGGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934911003 2:98254362-98254384 ACATTTAAGGGGATTGTGAATGG + Intronic
935142845 2:100369149-100369171 ATTTTTAAGGGGATTATGAAGGG + Intergenic
935742125 2:106159025-106159047 GTTTTTAAGGGTAGTTTGGTGGG - Intronic
935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG + Intergenic
936654050 2:114463806-114463828 GATTTGAAGGGGTTTGGGGAGGG - Intronic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938786772 2:134636974-134636996 GTTTTTAAGGATAATGTGGTGGG - Intronic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
939829473 2:147054558-147054580 GGTATTAAGGGGAGTTTGGAAGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
941510933 2:166408338-166408360 GCTTTTAAATGGATTGTTGATGG - Intronic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG + Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
944209260 2:197189454-197189476 GTAGTTAGGGGGAGTGTGGAAGG - Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948157795 2:235798479-235798501 TTTTTTAAGGACATGGTGGAAGG + Intronic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1170208421 20:13823982-13824004 GTGTTCAAGGGTATGGTGGAAGG - Intergenic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1177179211 21:17726684-17726706 GTTTTGAAGGGGAATCTGTACGG + Intergenic
1178297968 21:31426882-31426904 GTTTTTGAGGGGCTTGGGGTGGG + Intronic
1180234572 21:46450011-46450033 GCTTTTGAGGTGATTGTGGTGGG - Intergenic
1180917765 22:19500700-19500722 GCTTTTAGGGAGACTGTGGAGGG - Intronic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1184757324 22:46524426-46524448 GTTGTCATGGGGATTGTGCAGGG - Intronic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
953827466 3:46266287-46266309 GTTTTAGAGGTGAGTGTGGAAGG - Exonic
954820840 3:53326179-53326201 AATGTTAATGGGATTGTGGAAGG - Intronic
955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG + Intergenic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
956689248 3:71860898-71860920 GTTTATATGGGGAATGTGGCAGG - Intergenic
957099771 3:75812278-75812300 GTTCTTAAGGGGAATGTGTTGGG - Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957726595 3:84073904-84073926 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG + Intergenic
959961045 3:112298374-112298396 GTTTACTAGGGGATTGAGGATGG - Intergenic
960744357 3:120870251-120870273 TTTTTTAATGGGCTTGTGGCAGG - Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963108057 3:141663509-141663531 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
964102784 3:153006883-153006905 GTTTTCTGGGGGAATGTGGATGG - Intergenic
964470977 3:157055388-157055410 GCTTTTAATGGGATATTGGAAGG - Intergenic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG + Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
979749382 4:124258675-124258697 GTTTTTATTGTGGTTGTGGATGG + Intergenic
980963558 4:139499654-139499676 GTTTTTAAGGGTACTTTGGTGGG - Intronic
981812590 4:148792800-148792822 GTTTTTCAGGGAAGTGTGGTAGG - Intergenic
982539198 4:156646058-156646080 ATCCTTAAGGGGATTCTGGAAGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG + Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
987351866 5:17029537-17029559 CTTTTTAATGGGATTGTTGGGGG - Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG + Exonic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993540345 5:89141561-89141583 GTTTTTAAGAAGGTTGTGAAAGG + Intergenic
994601600 5:101912354-101912376 CTTTTTGAGGGAATTGTGAATGG + Intergenic
994798480 5:104338318-104338340 ATTTTTCAGGGGATTGTGTTAGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995640000 5:114244609-114244631 GTTATTGGGGGGAGTGTGGAGGG + Intergenic
995820192 5:116221276-116221298 GATTTTAAGGAGATAGTAGAGGG - Intronic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996985941 5:129564590-129564612 GATTTTACGAGGATTTTGGAAGG + Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG + Intergenic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004485073 6:16058704-16058726 GTTTTTAAGGGAAAGATGGAGGG - Intergenic
1006030193 6:31172179-31172201 GTCTTTGAGGGGATTGCAGAGGG - Intronic
1006216480 6:32448109-32448131 GTTGTTAAGGTGATTGTGTGGGG - Intergenic
1007466922 6:42059018-42059040 GTTTTTAAGGATAATGTGGTAGG + Intronic
1007803032 6:44413893-44413915 GTTTTTATTAGGAATGTGGAAGG + Intronic
1007865570 6:44965772-44965794 GTATTTAAGATGATAGTGGAAGG - Intronic
1007921330 6:45612193-45612215 GTATTTATGGAGATTGTGGGAGG - Intronic
1008173668 6:48239714-48239736 CTTTTTAATGGGATTGTTAATGG - Intergenic
1011326557 6:86154603-86154625 GTATTAAAGGGGATGGTGAATGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012586575 6:100930535-100930557 CTTTTTAATGGGATTTTGGTTGG + Intergenic
1012846030 6:104390003-104390025 GTTTTTTAGTGGATTCTGTAGGG - Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1014499845 6:122172813-122172835 ATTTTTGATGGTATTGTGGATGG - Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1017248929 6:152259150-152259172 GATTTTAAGGGGATGCTGGGTGG - Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019202128 6:170326592-170326614 GTTGTGACGGGGACTGTGGAAGG - Intronic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019771330 7:2885422-2885444 GTTTTGATGGGGACTGTGGCTGG + Intergenic
1020409669 7:7877047-7877069 GTGTTTAAGGGGTCTGTGGGTGG + Intronic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1021957100 7:25836472-25836494 GTTTTTAAAGAGATTGTCCAAGG - Intergenic
1022010074 7:26301146-26301168 GTTTTTGGGGGGATTTGGGAAGG - Intronic
1022338905 7:29450235-29450257 GTTTTTAAGGATTTTGTGGTAGG + Intronic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG + Exonic
1023970728 7:44988828-44988850 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031455268 7:121971428-121971450 ATTTTTATGGGGAGTGTTGAGGG + Intronic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034277550 7:149830319-149830341 GTGACTAAGGGGACTGTGGAGGG - Intergenic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035288762 7:157823867-157823889 GTCTCTAAGGGGAATCTGGAGGG + Intronic
1037885593 8:22594572-22594594 GCTTTGGAGGGGATGGTGGAGGG + Intronic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG + Intronic
1039345927 8:36705119-36705141 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1039863388 8:41479139-41479161 GGATTTAATGGGAATGTGGACGG - Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041758816 8:61341806-61341828 GCTTTTAAGGGAATTTTGCAAGG + Intronic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG + Intergenic
1048700488 8:137083221-137083243 GTTTTTAAGGGAATCTTGGTGGG + Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049053822 8:140219574-140219596 GGTTATAAGGGGGTCGTGGAAGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1051759288 9:20443182-20443204 GTTTTTTATGGGATGGTGGTAGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052295801 9:26895046-26895068 GTTTTTAAGGGAATTTTGGTGGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1057584630 9:96318147-96318169 GCTTTTAAGAGGCTTCTGGAGGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057781625 9:98055331-98055353 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1062137198 9:134935510-134935532 GTTTTTCCCGGGTTTGTGGAAGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186264191 X:7813950-7813972 GTTTTTAAGGGAATTTTGGTGGG + Intergenic
1186475882 X:9857333-9857355 GATTTTAGGGGGAGTGGGGATGG + Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187091262 X:16099277-16099299 GTTTTTAAGTGTATTTTGGTGGG - Intergenic
1188286292 X:28328898-28328920 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1188796823 X:34477266-34477288 TTTTTTAAGGCAATTGTGAATGG + Intergenic
1188811189 X:34656446-34656468 TTTTTTAACGGGGGTGTGGAAGG + Intronic
1189106700 X:38244203-38244225 GTTTTTAAGAGTCTTGTGGCTGG + Intronic
1189415235 X:40806892-40806914 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1189619647 X:42821926-42821948 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG + Intronic
1190604978 X:52131794-52131816 GTTTTTATGGCTATTGTGAATGG - Intergenic
1190722091 X:53157833-53157855 GTTTTCAAGGGGATGGGGGTGGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1193187234 X:78527841-78527863 TTTATTAAGGTGATTGTGCATGG + Intergenic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195017514 X:100793894-100793916 CTGTTTCAGGGGATTGTGCAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG + Intronic
1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG + Intronic
1198605472 X:138332503-138332525 GTTTTTAAGGGAATGATGGCAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic