ID: 989575709 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:42986349-42986371 |
| Sequence | CTCAATCTACAGATGGGGTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 989575703_989575709 | 5 | Left | 989575703 | 5:42986321-42986343 | CCTCCAAATATCATGTTGAAATG | No data | ||
| Right | 989575709 | 5:42986349-42986371 | CTCAATCTACAGATGGGGTCTGG | No data | ||||
| 989575704_989575709 | 2 | Left | 989575704 | 5:42986324-42986346 | CCAAATATCATGTTGAAATGTAA | No data | ||
| Right | 989575709 | 5:42986349-42986371 | CTCAATCTACAGATGGGGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 989575709 | Original CRISPR | CTCAATCTACAGATGGGGTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||