ID: 989575709

View in Genome Browser
Species Human (GRCh38)
Location 5:42986349-42986371
Sequence CTCAATCTACAGATGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989575703_989575709 5 Left 989575703 5:42986321-42986343 CCTCCAAATATCATGTTGAAATG No data
Right 989575709 5:42986349-42986371 CTCAATCTACAGATGGGGTCTGG No data
989575704_989575709 2 Left 989575704 5:42986324-42986346 CCAAATATCATGTTGAAATGTAA No data
Right 989575709 5:42986349-42986371 CTCAATCTACAGATGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989575709 Original CRISPR CTCAATCTACAGATGGGGTC TGG Intergenic
No off target data available for this crispr