ID: 989577365

View in Genome Browser
Species Human (GRCh38)
Location 5:43000696-43000718
Sequence CAGTAGGCTGACACTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989577365_989577373 18 Left 989577365 5:43000696-43000718 CCTTTGAGAGTGTCAGCCTACTG No data
Right 989577373 5:43000737-43000759 AACCAAAGTTCCAAGACTGCTGG No data
989577365_989577376 28 Left 989577365 5:43000696-43000718 CCTTTGAGAGTGTCAGCCTACTG No data
Right 989577376 5:43000747-43000769 CCAAGACTGCTGGCTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989577365 Original CRISPR CAGTAGGCTGACACTCTCAA AGG (reversed) Intergenic